ÁREA DO FORNECEDOR

ACESSO RESTRITO








Conheça aqui os critérios utilizados na concepção e operacionalização deste Portal.

Clique aqui e saiba como fazer seu cadastro no Portal do Fornecedor.

Conheça aqui a Política do Fornecedor.


Destaques


A FEPMVZ recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
    2065/2014
    31/12/2014 00:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física para Tutor de ensino a distancia
    3Unidade


    2726/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física Edital 002/2014 - Secretaria
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Analista de Sistemas Junior
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Enfermeiro
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Analista de Sistemas Pleno
    1Unidade


    2727/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 003/2014 Processo seletivo simplificado - Auxiliar de Projeto
    1Unidade


    2734/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Processo seletivo Edital 004/2014 - Analista I
    1Unidade


    3382/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Processo Seletivo Contratação de Pessoa Física Secretaria Executiva Edital: 006/2014
    1Unidade


    5046/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Auxiliar adminstrativo
    Descrição: Fundação de Estudo e Pesquisa em Medicina Veterinária e Zootecnia - FEPMVZ SOLICITAÇÃO DE REALIZAÇÃO DE PROCESSO SELETIVO Centro de Custo: Projeto: Projeto de manutenção e ampliação do Centro Regional de Referência para formação permanente de profissionais ligados a assistência de familiares e usuários de Crack da Universidade Federal de Minas Gerais no município de Belo Horizonte Coordenador: Frederico Duarte Garcia Contratação: (X) CLT ( ) Prestação de serviço PRE-REQUISITOS PARA A CONTRATAÇAO Função/Serviço: Auxiliar administrativo Salário/Valor: R$2.5000,00 (valor bruto com os encargos patronais) Período: Fevereiro / 2014 a julho de 2015 Forma de Pagamento: mensal/depósito em conta corrente Jornada de Trabalho (CLT): 6 horas diárias e 5 dias por semana Subordinação (CLT): Escolaridade: Nível superior dentro da área de administração, ou saúde, ou reabilitação. Fluente em língua inglesa Experiência: Experiência, em gestão geral e organização de eventos Atribuições: 1. Controle de agenda e compromissos 2. Planejamento de viagens 3. Despacho e conferência de documentos 4. Organização de arquivos 5. Atendimento telefônico 6. Recepção de colaboradores do CRR 7. Planejamento dos cursos e eventos do CRR 8. Atendimento a colaboradores do CRR 9. Organizar planning, redigir atas e súmulas de reuniões. 10. Conferência de documentos 11. Auxiliar no desenvolvimento e organização do CRR 12. Organização dos simpósios do CRR 13. Digitação e diagramação Exigências para desempenho das funções: Vagas: 1 (uma) Outros: Informação Complementar: CRITÉRIO PARA PONTUAÇAO Favor citar a pontuação que deve ser atribuída aos seguintes requisitos: 1 – Experiência Profissional: Serão atribuídos 70 (setenta) pontos na avaliação da experiência profissional e currículo, a qual será avaliada segundo os seguintes quesitos • Histórico de Conclusão do Curso de Graduação • Certificados/Declaração de Conhecimento em Informática • Certificado/Declaração de Curso de Línguas Estrangeiras. Experiência profissional relevante 2 – Prova de Entrevista: Serão atribuídos à entrevista 30 (trinta) pontos. Desta forma, solicito a contratação de pessoa física que atenda os requisitos informados acima. Belo Horizonte, 17/01/2013____ Professor: Frederico Garcia Assinatura:
    1Unidade


    5449/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Abertura de Processo Seletivo Simplificado - Edital 07/2014 Vaga - Assistente de processos R$ 1.600,00
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Abertura de Processo Seletivo Simplificado - Edital 07/2014 - Vaga Assistente Administrativo R$ 1.350,00
    1Unidade


    5938/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física- Edital 009/2014 Abertura de processo seletivo simplificado 01vaga para: Tecnico em Pesquisa R$ 1.200,00 01 vaga para: Epidemiologista R$ 1.500,00
    2Unidade


    5940/2014
    31/12/2014 00:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 005/2014 Abertura de processo seletivo simplificado 01 vaga para: Tecnico de Farmacia R$ 900,00 01 vaga para: Tecnico em Enfermagem R$ 812,36
    2Unidade


    7844/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Processo Seletivo
    Descrição: Edital 011/2014- Abertura de processo seletivo simplificado para contratação de empregados - 02 vagas para auxiliar administrativo R$ 900,00
    2Unidade


    9759/2014
    30/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física- Processo Seletivo 013/2014 Função: Tutor de Ensino a distância.
    1Unidade


    19216/2014
    31/10/2014 00:00:00
    Cotação Eletrônica Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Análises
    Descrição: Análises Niacina As vitaminas deverão ser quantificáveis acima dos seguintes valores: Niacina: 1,00 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises Vitamina B1 (Tiamina) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina B1: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises B2 (Riboflavina) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina B2: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises B6 (PIRIDOXINA) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina B6: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - ácido fólico/folatos As vitaminas deverão ser quantificáveis acima dos seguintes valores: Ácido fólico: 50,00 mcg/100g.
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - Vitamina A As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina A: 5,00 mcg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - Vitamina D As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina D: 5,00 mcg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises Vitamina E (tocoferóis) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina E: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - Ácido Ascórbico As vitaminas deverão ser quantificáveis acima dos seguintes valores: Ácido Ascórbico: 1,00 mg/100g
    20Unidade


    26414/2014
    03/11/2014 00:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Auxiliar de Serviços Gerais Salário - R$ 847,00 + R$ 144,80 = salário + Insalubridade Atribuições: - Auxiliar no cumprimento de atividades ligadas a fazenda e Hospital Veterinário - Auxiliar na fiscalização periódica das dependências internas e externas das Escola e Hospital Veterinário - Carregar e descarregar materiais, moveis e equipamentos diversos - Carregar e descarregar veículos de transportes
    1Unidade


    26564/2014
    31/12/2014 00:00:00
    Dispensa de licitação Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: serviço
    Descrição: - PRESTAÇÃO DE SERVIÇO DE PERFURAÇÃO DE (02) DOIS POÇOS DE 80m e 90m, instalação, realização de teste de vazão, fornecimento e instalações de quadro de comando elétrico e conjunto moto-bomba submersa para poço tubular profundo a ser instalado, no terreno do Exercito Brasileiro do RJ na Vila Militar em Deodoro-RJ, utilização de Mão de Obra especializada e equipamentos, e deverá ter sede ou escritório no Rio de Janeiro, sendo; * Será obrigatória a visita ao local por parte dos licitantes interessados, antes da apresentação de suas propostas. Os licitantes interessados deverão fazê-lo para conhecer as condições, assim como, coletar informações, dados e elementos que possam vir a ter influência no desenvolvimento dos trabalhos, de modo que não serão atendidas solicitações durante os serviços, sob o argumento de falta de conhecimento das condições de trabalho ou de dados da especificação, sendo que a mesma será agendado para o dia 07de agosto de 2014 Agnaldo, Tel: 021- 97662-7796 . Após a visita técnica será emitido pelo responsável o Atestado de visita técnica que deverá integrar obrigatoriamente o site licitacoes-e.com.br.
    2Unidade


    28512/2014
    03/11/2014 16:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física CLT para o cargo de Auxiliar de projetos. Salário - R$ 1.600,00 + Vale alimentação + vale transporte. Algumas atribuições: Atuar diretamente na área administrativa realizando as tarefas abaixo relacionadas: - Recebimento e arquivo de documentos - Assessoramento geral ao coordenador nas rotinas diárias e diferenciadas - Preparação, acompanhamento, agendamento, o estoque e a distribuição de material e serviços - Controlar o registro de patrimônio - Controle de pagamentos de material e serviços
    1Unidade


    29022/2014
    31/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Amicacina
    Descrição: Antimicrobiano Amicacina necessariamente.
    1Unidade
    Produto/Serviço: Cefalotina
    Descrição: Antimicrobiano Cefalotina necessariamente
    1Unidade
    Produto/Serviço: Sulfa+trimetropim
    Descrição: Antimicrobiano Sulfa+trimetropim necessariamente
    1Unidade
    Produto/Serviço: Cefatoxime
    Descrição: Antimicrobiano Cefatoxime necessariamente
    1Unidade
    Produto/Serviço: Cloranfenicol
    Descrição: Antimicrobiano Cloranfenicol necessariamente
    1Unidade


    29641/2014
    27/10/2014 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Gossypol-acetic acid - 1 grama
    Descrição: Gossypol-acetic acid - 1 grama
    1Frasco


    30003/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Edital 024/2014 - Auxiliar de Farmacia Salario R$ 942,14
    2Unidade


    30355/2014
    27/10/2014 00:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: cefalexina
    Descrição: Antibiotico
    1Unidade
    Produto/Serviço: Meloxican
    Descrição: ANTINFLAMATÓRIO
    1Frasco
    Produto/Serviço: Ivermectina
    Descrição: Vermífugo
    1Frasco
    Produto/Serviço: tramadol
    Descrição: Analgésico
    2Caixa


    30464/2014
    27/10/2014 00:00:00
    Dispensa de licitação Material de Escritório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Carrinho para torre
    Descrição: Carrinho para torre de computador
    3Unidade
    Produto/Serviço: estabilizador
    Descrição: estabilizador
    2Unidade
    Produto/Serviço: telefone
    Descrição: telefone sem fio intelbras
    1Unidade
    Produto/Serviço: telefone
    Descrição: telefone com fio intelbras pleno
    1Unidade
    Produto/Serviço: Pen Drive
    Descrição: Pen Drive 32 GB
    4Unidade
    Produto/Serviço: pilha
    Descrição: pilha alcalinas panasonic
    10Unidade
    Produto/Serviço: arquivo
    Descrição: arquivo de mesa acrilico transparente vertical
    4Unidade
    Produto/Serviço: Ficha de registro
    Descrição: ficha de registro de empregados ( modelo anexo)
    1Pacote
    Produto/Serviço: tesoura
    Descrição: tesoura CIS TS 65
    4Unidade
    Produto/Serviço: caneta
    Descrição: caneta marca texto pilot - rosa
    4Caixa
    Produto/Serviço: calculadora
    Descrição: calculadora CIS - C - 206 N
    3Unidade


    30925/2014
    31/10/2014 00:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Caixa para ferramentas em chapa de aço sanfonada, com medidas 17x20x40 cm
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Martelo de unha, 27 mm
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Alicate universal de 8 polegadas
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Alicate de pressão de aço, 10 polegadas
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Escova de aço com cabo de plástico ou madeira
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave de grifo para cano de 36 polegadas
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave de fenda, medida 1/8 x 3" (3,5 x 75 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave de fenda, medida 3/16 x 4" (5 x 100 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave de fenda, medida 1/4 x 5" (6 x 125 mm)
    Descrição: osteofix-d 600mg cpr.c/60 natulab
    1Caixa
    Produto/Serviço: Chave de fenda, medida 5/16 x 8" (8 x 200 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave Philips, medida 3/16 x 3" (PH1 x 75 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave Philips, medida 1/4 x 5" (PH2 x 125 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave Philips, medida 5/16 x 8" (PH8 x 200 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Trena de 5 metros
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Lâmina de serra manual
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Estopa para limpeza (saco de 1 Kg)
    Descrição: instalações experimentais
    1Saco
    Produto/Serviço: Pincel médio para metais, 1/2 polegada
    Descrição: instalações experimentais
    1Unidade


    30997/2014
    25/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: EDTA PA
    Descrição: Marcar Synth - frasco de 250 gramas
    1Frasco
    Produto/Serviço: Rolo de gaze grande tipo queijo 11 fios
    Descrição: seringas
    1Rolo
    Produto/Serviço: Caixa de lamina para bisturi número 22
    Descrição: seringas
    1Caixa
    Produto/Serviço: Pinça anatômica de dissecação - 16 cm
    Descrição: tubo para microhematócrio com heparina sódica
    3Unidade
    Produto/Serviço: Bobinas de sacos plásticos, tamanha 40 cm x 60 cm
    Descrição: tubo para microhematócrio com heparina sódica
    2Bobina
    Produto/Serviço: Caixas de luvas de latex para procedimentos
    Descrição: Tamanho P - Marca Supermax
    10Caixa
    Produto/Serviço: Alcool absoluto (99,9%)
    Descrição: Alcool absoluto (99,9%)
    20Litro


    31015/2014
    25/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Agua de injeção
    Descrição: Água de injeção para processamento bioquímico de amostras, marca Sanobiol - embalagens de 1 litro, caixa com 12 litros
    120Unidade


    31277/2014
    29/10/2014 16:00:00
    Dispensa de licitação Material de Escritório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Papel A4 Ofício (Chamex) - 1 Caixa c/ 10 Resmas de 500 Folhas (5.000 Folhas)
    Descrição: Papel A4 Ofício (Chamex) - 1 Caixa c/ 10 Resmas de 500 Folhas (5.000 Folhas)
    8Unidade


    31278/2014
    27/10/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Papel Toalha 23 x 21 branco (Official)
    Descrição: Papel Toalha 23 x 21 branco (Official)
    150Unidade


    31279/2014
    27/10/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Fragmentadora de papel 25fls em tira cd cartão S2500 App-tech
    Descrição: Fragmentadora de papel para 25 folhas em tiras. cd e cartão modelo S2500 App-tech
    1Unidade
    Produto/Serviço: Pincel marca texto amarelo gel 155707 Faber Castell CX 6 UN
    Descrição: Pincel marca texto amarelo textliner super gel Faber Castell
    1Unidade


    31280/2014
    27/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: compressor de ar condicionado
    Descrição: Compressor de ar condicionado split BTU 5600 ou superior modelo QAO75 BA-220-LG Não localizei o código para este produto porisso utilizei o de ar condicionado.
    1Unidade


    31281/2014
    29/10/2014 16:00:00
    Dispensa de licitação Material de Escritório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: carimbo
    Descrição: Carimbo 1 - Análise de projetos Carimbo 2 - Cópia Obsoleta Carimbo 3 - Recebido Obs: Modelos anexo
    3Unidade


    31458/2014
    28/10/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Alfa Amilase G7 R1 10x20mL + R2 2x25mL
    Descrição: Alfa Amilase G7 R1 10x20mL + R2 2x25mL
    3Kit
    Produto/Serviço: Albumina WS R 1x250mL
    Descrição: Albumina WS R 1x250mL
    2Kit
    Produto/Serviço: Creatinina WS R1 2x200mL + R2 1x100mL
    Descrição: Creatinina WS R1 2x200mL + R2 1x100mL
    1Kit
    Produto/Serviço: Uréia UV WS R1 2x200ml + R2 1x100ml
    Descrição: Uréia UV WS R1 2x200ml + R2 1x100ml
    2Kit
    Produto/Serviço: Gama-GT IFCC R1 5 x 40 mL + R2 1 x 50 mL
    Descrição: Gama-GT IRCC R1 5 x 40 mL + R2 1 x 50 mL
    2Kit
    Produto/Serviço: TGP (ALAT GPT IFCC) R1 5x40mL + R2 1x50mL
    Descrição: TGP (ALAT GPT IFCC) R1 5x40mL + R2 1x50mL
    2Kit
    Produto/Serviço: TGO (ASAT- GOT IFCC) R1 5x40 mL + R2 1x50 mL
    Descrição: TGO (ASAT- GOT IFCC) R1 5x40 mL + R2 1x50 mL
    2Kit
    Produto/Serviço: Proteína Total WS R1 5x40mL + R2 1x50mL
    Descrição: Proteína Total WS R1 5x40mL + R2 1x50mL
    2Kit
    Produto/Serviço: Triglicerideos GPO-PAP R 1x250ml + 1x3ml Padrão
    Descrição: Triglicerideos GPO-PAP R 1x250ml + 1x3ml Padrão
    1Kit
    Produto/Serviço: TopKon N 4x5mL
    Descrição: TopKon N 4x5mL
    2Kit
    Produto/Serviço: Fosfatase Alcalina IFCC R1 5x40mL + R2 1x50mL
    Descrição: Fosfatase Alcalina IFCC R1 5x40mL + R2 1x50mL
    1Kit


    31462/2014
    28/10/2014 16:00:00
    Dispensa de licitação Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Manutenção de impressora modelo - RICOH AFÍCIO MP 201 SPF
    Descrição: Manutenção de impressora modelo - RICOH AFÍCIO MP 201 SPF
    1Unidade


    31553/2014
    28/10/2014 16:00:00
    Pregão eletrônico Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: PHUSION FLASH
    Descrição: PHUSION FLASH - FUSION FLASH CÓD. CATALOGO: F-548L MARCA: THERMO HIGH FIDELITY PCR MASTER MIX 500 REAÇÕES
    10Pacote


    31596/2014
    29/10/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: Passagem aérea nacional para: Marcelo Costa IDA: 04/11 Natal/Salvador Gol 11:08 chegando 12:41 IDA: 10/11 Salvador/Campinas Azul 08:00 chegando 11:32 VOLTA: 13/11 Campinas/Natal Azul 22:04 chegando 00:25.
    1Unidade


    31618/2014
    29/10/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: MORFINA, SULFATO 10 MG/ML - 1ML -INJETÁVEL
    Descrição: MORFINA, SULFATO 10 MG/ML - 1ML -INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO A PARTIR DA DATA DE FORNECIMENTO. FORNECIMENTO PARCELADO EM 02 VEZES (02 ENTREGAS DE 300 AMPOLAS)
    600Ampola
    Produto/Serviço: FENTANILA - 0,05 MG / ML - C/ 10 ML SOLUÇÃO INJETÁVEL
    Descrição: FENTANILA - 0,05 MG / ML - C/ 10 ML SOLUÇÃO INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA (ENTREGA PARCELADA EM 02 VEZES DE 75 FRASCOS)
    150Frasco
    Produto/Serviço: METADONA, CLORIDRATO 10MG/ML C/ 1ML - SOLUÇÃO INJETÁVEL
    Descrição: METADONA, CLORIDRATO 10MG/ML AMPOLA C/ 1ML - SOLUÇÃO INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA (ENTREGA PARCELADA EM 02 VEZES DE 150 AMPOLAS CADA)
    300Ampola
    Produto/Serviço: PETIDINA - 50 MG/ML - C/ 2 ML - SOLUÇÃO INJETÁVEL
    Descrição: PETIDINA - 50 MG/ML - C/ 2 ML - SOLUÇÃO INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA
    50Litro
    Produto/Serviço: ISOFLURANO 1 MG/ML - C/ 100 ML - SOLUÇÃO INJETÁVEL
    Descrição: ISOFLURANO 1 MG/ML - C/ 100 ML - SOLUÇÃO INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA (ENTREGA PARCELADA EM 02 VEZES DE 25 FRASCOS)
    50Unidade
    Produto/Serviço: PROPOFOL - 10 MG/ML - C/ 20 ML - INJETÁVEL
    Descrição: PROPOFOL - 10 MG/ML - C/ 20 ML - INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA (ENTREGA PARCELADA EM 02 VEZES DE 100 FRASCOS)
    200Frasco
    Produto/Serviço: LIDOCAÍNA, CLORIDRATO 2% (20MG/ML) S/ VASOCONSTRITOR - FRASCO C/ 20ML - SOLUÇÃO INJETÁVEL
    Descrição: LIDOCAÍNA, CLORIDRATO 2% (20MG/ML) S/ VASOCONSTRITOR - FRASCO C/ 20ML - SOLUÇÃO INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA (ENTREGA PARCELADA EM 02 VEZES DE 150 FRASCOS)
    300Frasco
    Produto/Serviço: LIDOCAÍNA, CLORIDRATO 2% (20MG/ML) C/ VASOCONSTRITOR - FRASCO C/ 20ML - SOLUÇÃO INJETÁVEL
    Descrição: LIDOCAÍNA, CLORIDRATO 2% (20MG/ML) C/ VASOCONSTRITOR - FRASCO C/ 20ML - SOLUÇÃO INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA (ENTREGA PARCELADA EM 02 VEZES DE 30 E 20 FRASCOS RESPECTIVAMENTE)
    50Frasco
    Produto/Serviço: BUPIVACAÍNA, CLORIDRATO 0,5% (5MG/ML) S/ VASOCONSTRITOR - FRASCO C/ 20 ML - SOLUÇÃO INJETÁVEL
    Descrição: BUPIVACAÍNA, CLORIDRATO 0,5% (5MG/ML) S/ VASOCONSTRITOR - FRASCO C/ 20 ML - SOLUÇÃO INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA (ENTREGA PARCELADA EM 02 VEZES DE 20 FRASCOS)
    40Caixa
    Produto/Serviço: BUPIVACAÍNA, CLORIDRATO 0,5% (5MG/ML) C/ VASOCONSTRITOR - FRASCO C/ 20 ML - SOLUÇÃO INJETÁVEL
    Descrição: BUPIVACAÍNA, CLORIDRATO 0,5% (5MG/ML) C/ VASOCONSTRITOR - FRASCO C/ 20 ML - SOLUÇÃO INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA (ENTREGA PARCELADA EM 02 VEZES DE 30 FRASCOS)
    60Frasco
    Produto/Serviço: ROPIVACAÍNA, CLORIDRATO 7,5 MG/ML - FRASCO AMPOLA C/ 20 ML - SOLUÇÃO INJETÁVEL
    Descrição: ROPIVACAÍNA, CLORIDRATO 7,5 MG/ML - FRASCO AMPOLA C/ 20 ML - SOLUÇÃO INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA - FRASCO C/ 20 ML - SOLUÇÃO INJETÁVEL
    20Unidade


    31761/2014
    29/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: primers
    Descrição: Primer gP90 F- CAGTGGATCCTTCCCGGGGTGTAGA Primer gP90 R - CAATCTGCAGAATTAGTCCAGTGTTAG escala de síntese 100nMol - desalinizado.
    1Par


    31762/2014
    29/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: primers
    Descrição: BIF - snested F - AGCCACCCAGACATCATGTT
    1Frasco


    31841/2014
    29/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: pipetas
    Descrição: 8 unidades de pipeta graduada de 2ml
    8Unidade
    Produto/Serviço: pipetas
    Descrição: 10 unidades de pipeta graduada de 5ml
    10Unidade
    Produto/Serviço: Tubo de ensaio simples
    Descrição: 50 tubos de ensaio simples com tampa de rosca nas dimensãoe 10x100mm
    50Unidade
    Produto/Serviço: Acido sulfurico PA
    Descrição: 6 ltros de acido sulfurico PA
    6Litro
    Produto/Serviço: hidroxido de sódio
    Descrição: 6 litros de hidroxido de sódio PA
    6Litro
    Produto/Serviço: Sulfato de prata PA
    Descrição: 100g de sulfato de prata PA
    100Grama
    Produto/Serviço: Vermelho de metila PA
    Descrição: 100 gramas de vermelho de metila PA
    100Grama
    Produto/Serviço: Azul de metileno
    Descrição: 100 gramas de Azul de metileno PA
    100Grama
    Produto/Serviço: Azida sódica
    Descrição: 250 gramas de azida sódica PA
    250Grama
    Produto/Serviço: Iodeto de potássio
    Descrição: 250 gramas de Iodeto de potássio PA
    250Grama
    Produto/Serviço: Dicromato de potássio
    Descrição: 500 gramas de Dicromato de potássio PA
    500Grama
    Produto/Serviço: Tiossulfato de sódio
    Descrição: 500 gramas de Tiossulfato de sódio PA
    500Grama
    Produto/Serviço: Amido soluvel
    Descrição: 250 gramas de Amido solúvel
    250Grama
    Produto/Serviço: Sulfato manganoso
    Descrição: 1000 gramas de Sulfato manganoso PA
    1000Grama
    Produto/Serviço: Sulfato de magnésio
    Descrição: 500 gramas de sulfato de magnésio
    500Grama
    Produto/Serviço: Cloreto de cálcio
    Descrição: 500 gramas de Cloreto de cálcio PA
    500Grama
    Produto/Serviço: Cloreto ferrico
    Descrição: 500 gramas de Cloreto ferrico PA
    500Grama
    Produto/Serviço: Fosfato monopotássico (KH2PO4)
    Descrição: 500 gramas de Fosfato monopotássico (KH2PO4)
    500Grama
    Produto/Serviço: Fosfato de potássio dibásico anidro (K2HPO4)
    Descrição: 500 gramas de Fosfato de potássio dibásico anidro (K2HPO4)
    500Grama
    Produto/Serviço: Fosfato de sódio bibásico heptahidratado (K2HPO4.7H20)
    Descrição: 500 gramas de Fosfato de sódio bibásico heptahidratado (K2HPO4.7H20)
    500Grama
    Produto/Serviço: Cloreto de amôneo (NH4Cl)
    Descrição: 500 gramas de Cloreto de amôneo (NH4Cl)
    500Grama
    Produto/Serviço: ácido bórico (H3BO3)
    Descrição: 100 gramas de ácido bórico (H3B03)
    100Grama
    Produto/Serviço: Acido ascórbico
    Descrição: 1000 gramas de ácido ascórbico
    1000Grama
    Produto/Serviço: Sulfato de potássio
    Descrição: 500 gramas de Sulfato de potássio
    500Grama
    Produto/Serviço: Sulfato de cobre
    Descrição: 500 gramas de Sulfato de cobre
    500Grama
    Produto/Serviço: Tartarato de sódio e potássio
    Descrição: 1000 gramas de Tartarato de sódio e potássio
    1000Grama