ÁREA DO FORNECEDOR

ACESSO RESTRITO








Conheça aqui os critérios utilizados na concepção e operacionalização deste Portal.

Clique aqui e saiba como fazer seu cadastro no Portal do Fornecedor.

Conheça aqui a Política do Fornecedor.


Destaques


A FEPMVZ recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
    2065/2014
    31/12/2014 00:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física para Tutor de ensino a distancia
    3Unidade


    2726/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física Edital 002/2014 - Secretaria
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Analista de Sistemas Junior
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Enfermeiro
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Analista de Sistemas Pleno
    1Unidade


    2727/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 003/2014 Processo seletivo simplificado - Auxiliar de Projeto
    1Unidade


    2734/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Processo seletivo Edital 004/2014 - Analista I
    1Unidade


    3382/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Processo Seletivo Contratação de Pessoa Física Secretaria Executiva Edital: 006/2014
    1Unidade


    5046/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Auxiliar adminstrativo
    Descrição: Fundação de Estudo e Pesquisa em Medicina Veterinária e Zootecnia - FEPMVZ SOLICITAÇÃO DE REALIZAÇÃO DE PROCESSO SELETIVO Centro de Custo: Projeto: Projeto de manutenção e ampliação do Centro Regional de Referência para formação permanente de profissionais ligados a assistência de familiares e usuários de Crack da Universidade Federal de Minas Gerais no município de Belo Horizonte Coordenador: Frederico Duarte Garcia Contratação: (X) CLT ( ) Prestação de serviço PRE-REQUISITOS PARA A CONTRATAÇAO Função/Serviço: Auxiliar administrativo Salário/Valor: R$2.5000,00 (valor bruto com os encargos patronais) Período: Fevereiro / 2014 a julho de 2015 Forma de Pagamento: mensal/depósito em conta corrente Jornada de Trabalho (CLT): 6 horas diárias e 5 dias por semana Subordinação (CLT): Escolaridade: Nível superior dentro da área de administração, ou saúde, ou reabilitação. Fluente em língua inglesa Experiência: Experiência, em gestão geral e organização de eventos Atribuições: 1. Controle de agenda e compromissos 2. Planejamento de viagens 3. Despacho e conferência de documentos 4. Organização de arquivos 5. Atendimento telefônico 6. Recepção de colaboradores do CRR 7. Planejamento dos cursos e eventos do CRR 8. Atendimento a colaboradores do CRR 9. Organizar planning, redigir atas e súmulas de reuniões. 10. Conferência de documentos 11. Auxiliar no desenvolvimento e organização do CRR 12. Organização dos simpósios do CRR 13. Digitação e diagramação Exigências para desempenho das funções: Vagas: 1 (uma) Outros: Informação Complementar: CRITÉRIO PARA PONTUAÇAO Favor citar a pontuação que deve ser atribuída aos seguintes requisitos: 1 – Experiência Profissional: Serão atribuídos 70 (setenta) pontos na avaliação da experiência profissional e currículo, a qual será avaliada segundo os seguintes quesitos • Histórico de Conclusão do Curso de Graduação • Certificados/Declaração de Conhecimento em Informática • Certificado/Declaração de Curso de Línguas Estrangeiras. Experiência profissional relevante 2 – Prova de Entrevista: Serão atribuídos à entrevista 30 (trinta) pontos. Desta forma, solicito a contratação de pessoa física que atenda os requisitos informados acima. Belo Horizonte, 17/01/2013____ Professor: Frederico Garcia Assinatura:
    1Unidade


    5449/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Abertura de Processo Seletivo Simplificado - Edital 07/2014 Vaga - Assistente de processos R$ 1.600,00
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Abertura de Processo Seletivo Simplificado - Edital 07/2014 - Vaga Assistente Administrativo R$ 1.350,00
    1Unidade


    5938/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física- Edital 009/2014 Abertura de processo seletivo simplificado 01vaga para: Tecnico em Pesquisa R$ 1.200,00 01 vaga para: Epidemiologista R$ 1.500,00
    2Unidade


    5940/2014
    31/12/2014 00:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 005/2014 Abertura de processo seletivo simplificado 01 vaga para: Tecnico de Farmacia R$ 900,00 01 vaga para: Tecnico em Enfermagem R$ 812,36
    2Unidade


    7844/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Processo Seletivo
    Descrição: Edital 011/2014- Abertura de processo seletivo simplificado para contratação de empregados - 02 vagas para auxiliar administrativo R$ 900,00
    2Unidade


    9759/2014
    30/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física- Processo Seletivo 013/2014 Função: Tutor de Ensino a distância.
    1Unidade


    26414/2014
    03/11/2014 00:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Auxiliar de Serviços Gerais Salário - R$ 847,00 + R$ 144,80 = salário + Insalubridade Atribuições: - Auxiliar no cumprimento de atividades ligadas a fazenda e Hospital Veterinário - Auxiliar na fiscalização periódica das dependências internas e externas das Escola e Hospital Veterinário - Carregar e descarregar materiais, moveis e equipamentos diversos - Carregar e descarregar veículos de transportes
    1Unidade


    26564/2014
    31/12/2014 00:00:00
    Dispensa de licitação Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: serviço
    Descrição: - PRESTAÇÃO DE SERVIÇO DE PERFURAÇÃO DE (02) DOIS POÇOS DE 80m e 90m, instalação, realização de teste de vazão, fornecimento e instalações de quadro de comando elétrico e conjunto moto-bomba submersa para poço tubular profundo a ser instalado, no terreno do Exercito Brasileiro do RJ na Vila Militar em Deodoro-RJ, utilização de Mão de Obra especializada e equipamentos, e deverá ter sede ou escritório no Rio de Janeiro, sendo; * Será obrigatória a visita ao local por parte dos licitantes interessados, antes da apresentação de suas propostas. Os licitantes interessados deverão fazê-lo para conhecer as condições, assim como, coletar informações, dados e elementos que possam vir a ter influência no desenvolvimento dos trabalhos, de modo que não serão atendidas solicitações durante os serviços, sob o argumento de falta de conhecimento das condições de trabalho ou de dados da especificação, sendo que a mesma será agendado para o dia 07de agosto de 2014 Agnaldo, Tel: 021- 97662-7796 . Após a visita técnica será emitido pelo responsável o Atestado de visita técnica que deverá integrar obrigatoriamente o site licitacoes-e.com.br.
    2Unidade


    28512/2014
    03/11/2014 16:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física CLT para o cargo de Auxiliar de projetos. Salário - R$ 1.600,00 + Vale alimentação + vale transporte. Algumas atribuições: Atuar diretamente na área administrativa realizando as tarefas abaixo relacionadas: - Recebimento e arquivo de documentos - Assessoramento geral ao coordenador nas rotinas diárias e diferenciadas - Preparação, acompanhamento, agendamento, o estoque e a distribuição de material e serviços - Controlar o registro de patrimônio - Controle de pagamentos de material e serviços
    1Unidade


    30003/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Edital 024/2014 - Auxiliar de Farmacia Salario R$ 942,14
    2Unidade


    30925/2014
    30/11/2014 00:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Caixa para ferramentas em chapa de aço sanfonada, com medidas 17x20x40 cm
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Martelo de unha, 27 mm
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Alicate universal de 8 polegadas
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Alicate de pressão de aço, 10 polegadas
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Escova de aço com cabo de plástico ou madeira
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave de grifo para cano de 36 polegadas
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave de fenda, medida 1/8 x 3" (3,5 x 75 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave de fenda, medida 3/16 x 4" (5 x 100 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave de fenda, medida 1/4 x 5" (6 x 125 mm)
    Descrição: osteofix-d 600mg cpr.c/60 natulab
    1Caixa
    Produto/Serviço: Chave de fenda, medida 5/16 x 8" (8 x 200 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave Philips, medida 3/16 x 3" (PH1 x 75 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave Philips, medida 1/4 x 5" (PH2 x 125 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Chave Philips, medida 5/16 x 8" (PH8 x 200 mm)
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Trena de 5 metros
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Lâmina de serra manual
    Descrição: instalações experimentais
    1Unidade
    Produto/Serviço: Estopa para limpeza (saco de 1 Kg)
    Descrição: instalações experimentais
    1Saco
    Produto/Serviço: Pincel médio para metais, 1/2 polegada
    Descrição: instalações experimentais
    1Unidade


    31553/2014
    03/11/2014 16:00:00
    Pregão eletrônico Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: PHUSION FLASH
    Descrição: PHUSION FLASH - FUSION FLASH CÓD. CATALOGO: F-548L MARCA: THERMO HIGH FIDELITY PCR MASTER MIX 500 REAÇÕES
    10Pacote


    31760/2014
    04/11/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: SACAROSE SIGMA ULTRA S7903-250G
    Descrição: Marca Sigma, código S7903-250G.
    1Frasco
    Produto/Serviço: TEMED REAGENTE PARA ELETROFORESE - T9281-25ML
    Descrição: Reagente Temed - Marca Sigma T9281-25ML
    1Pote
    Produto/Serviço: DAB - 3,3 DIAMINOBENZIDINE TABLETS 50 SET - SIGMA/ALDRICH
    Descrição: Marca SIGMA/ALDRICH - D4293
    1Caixa
    Produto/Serviço: IPTG - Isopropyl ß-D-1-thiogalactopyranoside =99% (TLC), =0.1% Dioxane
    Descrição: IPTG - SIGMA - I6758-5G - Frasco com 5 gramas.
    1Pote
    Produto/Serviço: Tampão TE 25mL
    Descrição: Tampão TE solução estéril pronta para uso pHT
    1Frasco
    Produto/Serviço: Albumin from bovine serum, protein standard
    Descrição: Albumina Sigma - P0914-5AMP - Ampola com 1 mL.
    1Frasco


    31761/2014
    07/11/2014 15:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: primers
    Descrição: Primer gP90 F- CAGTGGATCCTTCCCGGGGTGTAGA Primer gP90 R - CAATCTGCAGAATTAGTCCAGTGTTAG escala de síntese 100nMol - desalinizado.
    1Par


    31949/2014
    01/11/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Livro
    Descrição: Gordis L. Epidemiologia. Editora Revinter. 2010. 4ª Edição
    1Unidade


    32399/2014
    02/11/2014 16:00:00
    Dispensa de licitação Material de Escritório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Pasta
    Descrição: Pasta sanfonada tamanho A4, com 12 divisórias.
    2Unidade


    32456/2014
    04/11/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: luva
    Descrição: luva de latex para procedimento não estéril tamanho: G
    4Caixa


    33058/2014
    02/11/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Mangueira de silicone
    Descrição: Mangueira de silicone tamanho 204 (pedido 40 metros)
    40Metro


    33070/2014
    03/11/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Análises
    Descrição: 1 KIT comercial da empresa Randox® para determinação de ácidos graxos não esterificados (AGNE);
    1Unidade
    Produto/Serviço: Análises
    Descrição: KIT comercial da empresa Randox® para determinação de D-ß-Hidroxibutirato (BHBA);
    1Unidade
    Produto/Serviço: Análises
    Descrição: 1 KIT comercial enzimático colorimétrico para a determinação de glicose (KATAL®);
    1Unidade
    Produto/Serviço: Análises
    Descrição: 1 KIT comercial de radioimunoinsaio para a determinação de insulina (Porcine insulin Millipore®);
    1Unidade
    Produto/Serviço: Microplacas para PCR
    Descrição: 10 placas para RT-PCR
    10Unidade
    Produto/Serviço: Análises
    Descrição: 1 KIT dNTP Set (100mM) (Invitrogen™) – código 10297-018
    1Unidade
    Produto/Serviço: oligonucleotídeos
    Descrição: VER PEDIDO EM ANEXO
    1Unidade


    33265/2014
    04/11/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Aluguel de Material
    Descrição: Aluguel de Material Segue em anexo os orçamentos. Aluguel de equipamento completo para tradução simultânea em palestra, suficiente para 200 pessoas. Exceto cabine de tradução, no auditório já existe local apropriado para tradutor.
    1Unidade


    33358/2014
    05/11/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Epidemiologia Nutricional
    Descrição: Autores: ROSELY SICHIERI, GILBERTO KAC, DENISE PETRUCCI GIGANTE FIOCRUZ
    1Unidade


    33360/2014
    05/11/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: oligonucleotídeos
    Descrição: oligonucleotídeos
    18Unidade


    33434/2014
    05/11/2014 16:00:00
    Dispensa de licitação Material de Escritório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Toner HP
    Descrição: Toner laserjet 126A/CE310A preto para impressora HP 100 color MFP M175nw.
    1Unidade


    33474/2014
    05/11/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Maria do Horto Cartana indo dia 09/11 Florianopolis/Cuiaba Gol 11:43 chegando 16:10 dia 12/09 Cuiaba/Campo Grande Azul 09:41 chegando 11:20 volta dia 14/09 Campo Grande/Florianopolis Gol 15:00 chegando 21:15. favor enviar eticket para samulacerda@uol.com.br
    1Unidade


    33489/2014
    05/11/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Ágar Baird Parker
    Descrição: AGAR BAIRD PARKER 500g da marca Acumedia
    3Frasco