ÁREA DO FORNECEDOR

ACESSO RESTRITO








Conheça aqui os critérios utilizados na concepção e operacionalização deste Portal.

Clique aqui e saiba como fazer seu cadastro no Portal do Fornecedor.

Conheça aqui a Política do Fornecedor.


Destaques


A FEPMVZ recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
    2065/2014
    31/12/2014 00:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física para Tutor de ensino a distancia
    3Unidade


    2726/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física Edital 002/2014 - Secretaria
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Analista de Sistemas Junior
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Enfermeiro
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Analista de Sistemas Pleno
    1Unidade


    2727/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 003/2014 Processo seletivo simplificado - Auxiliar de Projeto
    1Unidade


    2734/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Processo seletivo Edital 004/2014 - Analista I
    1Unidade


    3382/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Processo Seletivo Contratação de Pessoa Física Secretaria Executiva Edital: 006/2014
    1Unidade


    5046/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Auxiliar adminstrativo
    Descrição: Fundação de Estudo e Pesquisa em Medicina Veterinária e Zootecnia - FEPMVZ SOLICITAÇÃO DE REALIZAÇÃO DE PROCESSO SELETIVO Centro de Custo: Projeto: Projeto de manutenção e ampliação do Centro Regional de Referência para formação permanente de profissionais ligados a assistência de familiares e usuários de Crack da Universidade Federal de Minas Gerais no município de Belo Horizonte Coordenador: Frederico Duarte Garcia Contratação: (X) CLT ( ) Prestação de serviço PRE-REQUISITOS PARA A CONTRATAÇAO Função/Serviço: Auxiliar administrativo Salário/Valor: R$2.5000,00 (valor bruto com os encargos patronais) Período: Fevereiro / 2014 a julho de 2015 Forma de Pagamento: mensal/depósito em conta corrente Jornada de Trabalho (CLT): 6 horas diárias e 5 dias por semana Subordinação (CLT): Escolaridade: Nível superior dentro da área de administração, ou saúde, ou reabilitação. Fluente em língua inglesa Experiência: Experiência, em gestão geral e organização de eventos Atribuições: 1. Controle de agenda e compromissos 2. Planejamento de viagens 3. Despacho e conferência de documentos 4. Organização de arquivos 5. Atendimento telefônico 6. Recepção de colaboradores do CRR 7. Planejamento dos cursos e eventos do CRR 8. Atendimento a colaboradores do CRR 9. Organizar planning, redigir atas e súmulas de reuniões. 10. Conferência de documentos 11. Auxiliar no desenvolvimento e organização do CRR 12. Organização dos simpósios do CRR 13. Digitação e diagramação Exigências para desempenho das funções: Vagas: 1 (uma) Outros: Informação Complementar: CRITÉRIO PARA PONTUAÇAO Favor citar a pontuação que deve ser atribuída aos seguintes requisitos: 1 – Experiência Profissional: Serão atribuídos 70 (setenta) pontos na avaliação da experiência profissional e currículo, a qual será avaliada segundo os seguintes quesitos • Histórico de Conclusão do Curso de Graduação • Certificados/Declaração de Conhecimento em Informática • Certificado/Declaração de Curso de Línguas Estrangeiras. Experiência profissional relevante 2 – Prova de Entrevista: Serão atribuídos à entrevista 30 (trinta) pontos. Desta forma, solicito a contratação de pessoa física que atenda os requisitos informados acima. Belo Horizonte, 17/01/2013____ Professor: Frederico Garcia Assinatura:
    1Unidade


    5449/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Abertura de Processo Seletivo Simplificado - Edital 07/2014 Vaga - Assistente de processos R$ 1.600,00
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Abertura de Processo Seletivo Simplificado - Edital 07/2014 - Vaga Assistente Administrativo R$ 1.350,00
    1Unidade


    5938/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física- Edital 009/2014 Abertura de processo seletivo simplificado 01vaga para: Tecnico em Pesquisa R$ 1.200,00 01 vaga para: Epidemiologista R$ 1.500,00
    2Unidade


    5940/2014
    31/12/2014 00:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 005/2014 Abertura de processo seletivo simplificado 01 vaga para: Tecnico de Farmacia R$ 900,00 01 vaga para: Tecnico em Enfermagem R$ 812,36
    2Unidade


    7844/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Processo Seletivo
    Descrição: Edital 011/2014- Abertura de processo seletivo simplificado para contratação de empregados - 02 vagas para auxiliar administrativo R$ 900,00
    2Unidade


    9759/2014
    30/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física- Processo Seletivo 013/2014 Função: Tutor de Ensino a distância.
    1Unidade


    19216/2014
    30/09/2014 00:00:00
    Cotação Eletrônica Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Análises
    Descrição: Análises Niacina As vitaminas deverão ser quantificáveis acima dos seguintes valores: Niacina: 1,00 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises Vitamina B1 (Tiamina) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina B1: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises B2 (Riboflavina) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina B2: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises B6 (PIRIDOXINA) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina B6: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - ácido fólico/folatos As vitaminas deverão ser quantificáveis acima dos seguintes valores: Ácido fólico: 50,00 mcg/100g.
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - Vitamina A As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina A: 5,00 mcg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - Vitamina D As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina D: 5,00 mcg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises Vitamina E (tocoferóis) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina E: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - Ácido Ascórbico As vitaminas deverão ser quantificáveis acima dos seguintes valores: Ácido Ascórbico: 1,00 mg/100g
    20Unidade


    20326/2014
    30/09/2014 00:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física Edital 021/2014 Abertura de porcesso seletivo simplificado. Estatistico R$ 2.000,00 por produto entregue.
    1Unidade


    20646/2014
    19/09/2014 16:00:00
    Dispensa de licitação Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Manutenção de centrifuga refrigerada Eppendorf - Erro tipo 2
    Descrição: Manutenção de centrifuga refrigerada Eppendorf - Erro tipo 2 -
    1Unidade


    23940/2014
    19/09/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Infertile
    Descrição: Infertile
    400Frasco


    24824/2014
    22/09/2014 00:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Tecido
    Descrição: Tecido de brim pesado (100% algodão, 1,60 m de largura, sarja 3x1, gramatura 260g/m2) na cor verde bandeira (total do pedido 200 metros)
    200Metro
    Produto/Serviço: Tecido
    Descrição: Tecido de americano cru (100% algodão, 1,70 m de largura, sarja 3x1 pesada, gramatura 420 g/m2) - total do pedido 100 metros
    100Metro


    25729/2014
    22/09/2014 00:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: recarga gás nitrogênio
    Descrição: recarga gás nitrogênio
    500Litro


    25942/2014
    20/09/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Gentamicin Solution 10ml - Sigma-Aldrich (G1397)
    Descrição: Antibiótico para cultivo celular
    1Frasco
    Produto/Serviço: Fluoroshield™ 20ML Sigma-Aldrich (F6182)
    Descrição: Meio de montagem para microscopia de fluorescência
    1Frasco
    Produto/Serviço: Fluoroshield™ with DAPI 20ML Sigma-Aldrich (F6057)
    Descrição: Meio de montagem para microscopia de fluorescência com fluoróforo (DAPI)
    1Frasco


    26001/2014
    19/09/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: amoxicilina + clavulanato
    Descrição: Amoxicilina 1000mg + Clavulanato de potássio 200mg - pó liofilizado frasco-ampola.
    250Frasco


    26003/2014
    19/09/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: amoxicilina + clavulanato
    Descrição: amoxicilina 1000mg + clavulanato 200mg - pó liofilizado/ injetável - total de 400 frascos.
    40Caixa
    Produto/Serviço: Benzetacil
    Descrição: Benzetacil - benzilpenicilina benzatina 1.200.000 UI solução imjetável com 4 ml - total de 30 frascos
    3Caixa
    Produto/Serviço: gentamicina 80mg 50x2ml (gentamicin)
    Descrição: gentamicina 80mg 50x2ml - 40mg/mL- (gentamicin) - total de 100 ampolas
    1Caixa


    26008/2014
    19/09/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Luva PVC
    Descrição: Luva de procedimento, não estéril, descartável, 100% látex natural, anatômica, textura homogênea, alta sensibilidade ao tato, boa elasticidade e resistente à tração, ambidestra, comprimento mínimo de 25 cm, lubrificada com pó bioabsorvível, baixo teor de proteínas. Acondicionada em caixa com 100 unidades. Tamanho PEQUENO (P). Total de 3000 peças/UNIDADES. Edital 04/2014 - 534935 - Pregão Eletrônico
    3000Peça
    Produto/Serviço: Luva PVC
    Descrição: Luva de procedimento, não estéril, descartável, 100% látex natural, anatômica, textura homogênea, alta sensibilidade ao tato, boa elasticidade e resistente à tração, ambidestra, comprimento mínimo de 25 cm, lubrificada com pó bioabsorvível, baixo teor de proteínas. Acondicionada em caixa com 100 unidades. Tamanho MÉDIO (M). Total de 3000 peças/UNIDADES. Edital 04/2014 - 534935 - Pregão Eletrônico
    3000Peça
    Produto/Serviço: Luva PVC
    Descrição: Luva de procedimento, não estéril, descartável, 100% látex natural, anatômica, textura homogênea, alta sensibilidade ao tato, boa elasticidade e resistente à tração, ambidestra, comprimento mínimo de 25 cm, lubrificada com pó bioabsorvível, baixo teor de proteínas. Acondicionada em caixa com 100 unidades. Tamanho GRANDE (G). Total de 2000 peças/UNIDADES. Edital 04/2014 - 534935 - Pregão Eletrônico
    2000Peça
    Produto/Serviço: Extensor 20cm para equipo
    Descrição: Extensor para perfusão em PVC com primer aproximado de 0,2 ml, tubo de 20 cm com resistência apropriada, conector luer fêmea e luer lock reversível transparentes, com pega não inferior a 1,5 cm. Estéril, apirogênico, atóxico, embalado em papel grau cirúrgico ou filme termoplástico. Pedir amostra. Marcas de referência: HARTMANN e B BRAUN. Edital 04/2014 - 534935 - Pregão Eletrônico
    1200Unidade
    Produto/Serviço: Extensor 60cm para equipo
    Descrição: Extensor para perfusão em PVC com primer aproximado de 0,48 ml, tubo de 60 cm com resistência apropriada, conector luer fêmea e luer lock reversível transparentes, com pega não inferior a 1,5 cm. Estéril, apirogênico, atóxico, embalado em papel grau cirúrgico ou filme termoplástico. Pedir amostra. Marcas de referência: HARTMANN e B BRAUN.
    300Unidade
    Produto/Serviço: Extensor 120cm para equipo
    Descrição: Extensor para perfusão em PVC com primer aproximado de 0,96 ml, tubo de 120 cm com resistência apropriada, conector luer fêmea e luer lock reversível transparentes, com pega não inferior a 1,5 cm. Estéril, apirogênico, atóxico, embalado em papel grau cirúrgico ou filme termoplástico. Pedir amostra. Marcas de referência: HARTMANN e B BRAUN.
    200Unidade


    26087/2014
    19/09/2014 16:00:00
    Cotação Eletrônica Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Aparelho HI98130 mais soluções
    Descrição: Aparelho medidor de pH e condutividade HI98130 Soluções de Calibração (ph 4, ph 7, condutividade, armazenamento e limpeza)
    1Unidade


    26128/2014
    22/09/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Balança Portátil Pesca Mala Digital Com Gancho Até 45 Kg
    Descrição: Display de 4 digitos * Gancho Resistente * Capacidade Máxima: 45 kg * Capacidade Mínima: 10 g * Alta Precisão de Medição * Utiliza 2 Pilhas AAA para Alimentação (Incluídas) * Função Tara * 3 escalas de medidas: Kg (quilogramas), Lb (libras), Oz (Ounce)
    2Unidade


    26176/2014
    20/09/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Piridina P.A.
    Descrição: Piridina P.A., 1 litro
    1Litro
    Produto/Serviço: Ácido Barbitúrico PA
    Descrição: Ácido Barbitúrico PA, frasco com 100g
    1Frasco


    26265/2014
    22/09/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: ficoll histopaque plus
    Descrição: ficoll histopaque plus
    3Frasco


    26413/2014
    21/09/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Solange de Lima Freiria indo dia 08/10 Santos Dumont/Brasilia GOL 06:27 chegando 07:58 e volta dia 09/10 Brasilia/Santos Dumont GOL 19:24 chegando 20:56. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Maria Eliza Ferraresi indo dia 08/10 Campinas/Brasilia indo GOL 07:20 chegando 09:02 e volta dia 09/10 Azul Brasilia/campinas Azul 18:02 chegando 21:43. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para KATIUSCIA LARSEN DE ABREU AGUIAR indo dia 08/10 Rio Branco/Brasilia TAM 00:53 chegando 06:05 e volta dia 09/10 Brasilia/Rio Branco TAM 22:54 chegando 00:21. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Rafael Gomes Ditterich indo dia 08/10 Curitiba/Brasilia GOL 07:07 chegando 09:07 e volta dia 09/10 Brasilia/Curitiba GOL 20:18 chegando 22:22. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Camila Baccin indo dia 08/10 Florianopolis/Brasilia Avianca 07:55 chegando 10:10 e volta dia 09/10 Brasilia/Florianopolis Avianca 20:35 chegando 22:36. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Gerson Alves Pereira Júnior indo dia 08/10 Ribeirao Preto/Brasilia TAM 06:40 chegando 08:24 e volta dia 09/10 Brasilia/Ribeirao Preto TAM 20:53 chegando 22:33. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Maria da Penha Monteiro Oliva indo dia 08/10 Congonhas/Brasilia indo GOL 06:32 chegando 08:12 e volta dia 09/10 Brasilia/Congonhas GOL 18:10 chegando 19:40 favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Ciomara Maria Pérez Nunes indo dia 08/10 Confins/Brasilia GOL 08:05 chegando 09:35 e volta dia 09/10 Brasilia/Confins GOL 18:56 chegando 19:58. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Mercia Pandolfo Provin indo dia 08/10 Goiania/Brasilia TAM 05:50 chegando 06:37 e volta dia 09/10 Brasilia/Goiania GOL 17:56 chegando 18:30. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Luciana Venhofen Martinelli Tavares indo dia 08/10 Campo Grande/Brasilia TAM 07:05 chegando 09:55 e volta dia 09/10 Brasilia/Campo Grande TAM 19:59 chegando 20:35. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para karina diniz oliveira indo dia 08/10 Campinas/Brasilia GOL 07:20 chegando 09:02 e volta dia 09/10 Brasilia/Campinas AZUL 20:00 chegando 21:43 favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para MARCO ANTONIO DE VIVO BARROS indo dia 08/10 Joao Pessoa/Brasilia TAM 06:04 chegando 08:54 e volta dia 09/10 Brasilia/Joao Pessoa TAM 19:47 chegando 22:21. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Maria Fernanda Petroli Frutuoso indo dia 08/10 Congonhas/Brasilia GOL 06:32 chegando 08:12 e volta dia 09/10 Brasilia/Congonhas GOL 18:10 chegando 19:40. favor enviar eticket para samulacerda@uol.com.br
    1Unidade


    26414/2014
    03/11/2014 00:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Auxiliar de Serviços Gerais Salário - R$ 847,00 + R$ 144,80 = salário + Insalubridade Atribuições: - Auxiliar no cumprimento de atividades ligadas a fazenda e Hospital Veterinário - Auxiliar na fiscalização periódica das dependências internas e externas das Escola e Hospital Veterinário - Carregar e descarregar materiais, moveis e equipamentos diversos - Carregar e descarregar veículos de transportes
    1Unidade


    26429/2014
    21/09/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para: Antonio Cyrino IDA: 05/10 Congonhas x Florianopolis TAM 17:58 chegando 19:10 volta: 07/10 Florianopolis x Brasilia TAM 17:46 chegando 20:08.
    1Unidade


    26430/2014
    21/09/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Cristina Thum Kaefer indo dia 07/10 Porto Alegre/Brasilia GOL 17:40 chegando 20:04 e volta dia 09/10 Brasilia/Porto Alegre GOL 20:14 chegando 22:58. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Sandra Nívea Dos Reis Saraiva Falcao in dia 07/10 Fortaleza/Brasilia TAM 14:00 chegando 16:54 e volta dia 09/10 Brasilia/Fortaleza TAM 20:16 chegando 23:00. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Luciana Fonseca da Victória indo dia 07/10 Cuiaba/Brasilia AZul 10:06 chegando 12:44 e volta dia 09/10 Brasilia/Cuiaba AZUL 18:42 chegando 19:35. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Soraya Nedeff de Paula indo dia 07/10 Porto Velho/Brasilia TAM 13:24 chegando 17:09 e volta dia 09/10 Brasilia/Porto Velho TAM 22:20 chegando 00:20. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Maria das Graças Barbosa Peixoto indo dia 07/10 Fortaleza/Brasilia TAM 17:12 chegando 19:48 e volta dia 09/10 Brasilia/Fortaleza TAM 20:16 chegando 23:00. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para NELY CRISTINA MEDEIROS CAIRES indo dia 07/10 Manaus/Brasilia GOL 15:37 chegando 19:33 e volta dia 09/10 Brasilia/Manaus GOL 21:50 chegando 00:03. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Tamires Alexandre Félix indo dia 07/10 Fortaleza/Brasilia TAM 14:00 chegando 16:54 e volta dia 09/10 Brasilia/Fortaleza TAM 16:47 chegando 19:17. favor enviar eticket para samualcerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Larissa Chaves Pedreira Silva indo dia 07/10 Salvador/Brasilia Avianca 14:47 chegando 16:47 e volta dia 09/10 Brasilia/Salvador Avianca 20:09 chegando 22:02. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Herbert Leopoldo de F. Góes indo dia 07/10 Maringa/Brasilia Azul 14:03 chegando 19:31 e volta dia 09/10 Brasilia/Maringa Azul 18:02 chegando 23:30. favor enviar eticket para samualcerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para ARGEU JOSÉ DE ASSIS indo dia 07/10 Passo Fundo/Brasilia Azul 12:40 chegando 19:31 e volta dia 10/10 Brasilia/Passo Fundo Azil 05:58 chegando 12:15. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para ANN GRACIELLE MOREIRA GOMES indo dia 07/10 Campina Grande/Brasilia Azul 15:20 chegando 23:37 e volta dia 10/10 Braislia/Campina Grande AZul 10:25 chegando 14:50. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Adail Almeida Rollo indo dia 07/10 Campinas/Brasilia AZUL 22:36 chegando 00:17 e volta dia 10/10 Brasilia/Campinas AZUL 15:49 chegando 17:24. favor enviar eticket para samulacerda@uol.com.br
    1Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para Andrezza Marques Duque indo dia 08/10 Aracaju/Brasilia Avianca 04:55 chegando 08:10 e volta dia 09/10 Brasilia/Aracaju 20:09 chegando 23:32. favor enviar eticket para samulacerda@uol.com.br
    1Unidade


    26432/2014
    21/09/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para SILVONE SANTA BARBARA DA SILVA SANTOS indo dia 07/10 Salvador/Brasilia TAM 15:05 chegando 17:01 e volta dia 10/10 Brasilia/Salvador TAM 06:00 chegando 11:04. favor enviar eticket para samulacerda@uol.com.br
    1Unidade


    26564/2014
    22/09/2014 16:00:00
    Dispensa de licitação Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: serviço
    Descrição: - PRESTAÇÃO DE SERVIÇO DE PERFURAÇÃO DE (02) DOIS POÇOS DE 80m e 90m, instalação, realização de teste de vazão, fornecimento e instalações de quadro de comando elétrico e conjunto moto-bomba submersa para poço tubular profundo a ser instalado, no terreno do Exercito Brasileiro do RJ na Vila Militar em Deodoro-RJ, utilização de Mão de Obra especializada e equipamentos, e deverá ter sede ou escritório no Rio de Janeiro, sendo; * Será obrigatória a visita ao local por parte dos licitantes interessados, antes da apresentação de suas propostas. Os licitantes interessados deverão fazê-lo para conhecer as condições, assim como, coletar informações, dados e elementos que possam vir a ter influência no desenvolvimento dos trabalhos, de modo que não serão atendidas solicitações durante os serviços, sob o argumento de falta de conhecimento das condições de trabalho ou de dados da especificação, sendo que a mesma será agendado para o dia 07de agosto de 2014 Agnaldo, Tel: 021- 97662-7796 . Após a visita técnica será emitido pelo responsável o Atestado de visita técnica que deverá integrar obrigatoriamente o site licitacoes-e.com.br.
    2Unidade


    26585/2014
    22/09/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para: Cristiane Santos Soares CPF: 67876897568-RG:0574068716 IDA: 18/09/2014 TRECHO-SALVADOR/BELO HORIZONTE-voo-GOL - 1097- as 16:15hs VOLTA-20/09/2014 BELO HORIZONTE/SALVADOR-voo-GOL- 1096 - AS 18:39
    1Unidade


    26587/2014
    22/09/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: passagem aérea nacional para GISELLE DOS SANTOS FREITAS -*CPF: 88324281134 *RG: 20-262.751-TRECHO- UBERLANDIA/BELO HORIZONTE/UBERLANDIA-IDA - 18/09/2014- Pampulha-VOOAzul voo 2445 AS 13h00 VOLTA - 20/09/2014-Confins- Tam voo 3272 AS 16h14
    1Unidade


    26588/2014
    22/09/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Passagem
    Descrição: Passagem terrestre para Thatyane Rocha Ribeiro -CPF: 072.728.576-92 -RG: MG12502167 - Trecho-PEDRA AZUL/BELO HORIZONTE/PEDRA AZUL- IDA-17/09/2014-Gontijo (convencional)-18:00 - VOLTA-20/09/2014- Gontijo (convencional) 19:00
    1Unidade


    26591/2014
    22/09/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Passagem
    Descrição: Passagem terrestre para SONIA CHRISTINA MACIEL- CPF: 333.706.726-34 -RG: MG2770359 - TRECHO- JUIZ DE FORA/BELO HORIZONTE/JUIZ DE FORA-IDA-18/09/2014-ATUAL(CONVENCIONAL)-12:00HS - VOLTA-20/09/2014-ATUAL(CONVENCIONAL)-15:30HS
    1Unidade


    26621/2014
    22/09/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Cotovelo
    Descrição: Cotovelo 90o em aço galvanizado a fogo para água fria 1/2"
    30Peça
    Produto/Serviço: Luva em aço
    Descrição: Luva em aço galvanizado a fogo para água fria de 1/2"
    30Unidade
    Produto/Serviço: Niple Duplo
    Descrição: Niple Duplo em aço galvanizado a fogo para água fria 1/2"
    120Peça
    Produto/Serviço: União em aço
    Descrição: União fabricada em aço galvanizado a fogo, para água fria com assento conico de bronze/ferro de 1/2"
    30Unidade
    Produto/Serviço: Plug (bujão)
    Descrição: Plug (bujão) em PVC roscável 1/2"
    25Unidade
    Produto/Serviço: Registro Gaveta
    Descrição: Registro Gaveta PN 16 semi industrial e/ou industrial com acabamento bruto com corpo, cunha, haste fabricado em liga de bronze, gaxeta tipo PTFE industrial, volante fabricado em alunimio com acabamento em pintura epoxi, produto fabricado com conformidade com a norma NBR 15705, pressão de serviço 14BAR/14 kgf/cm3/199 de 3/4"
    4Peça
    Produto/Serviço: Registro Gaveta
    Descrição: Registro Gaveta PN 16 semi industrial e/ou industrial com acabamento bruto com corpo, cunha, haste fabricado em liga de bronze, gaxeta tipo PTFE industrial, volante fabricado em alunimio com acabamento em pintura epoxi, produto fabricado com conformidade com a norma NBR 15705, pressão de serviço 14BAR/14 kgf/cm3/199 psi de 1"
    4Peça
    Produto/Serviço: Registro Gaveta
    Descrição: Registro Gaveta PN 16 semi industrial e/ou industrial com acabamento bruto com corpo, cunha, haste fabricado em liga de bronze, gaxeta tipo PTFE industrial, volante fabricado em alunimio com acabamento em pintura epoxi, produto fabricado com conformidade com a norma NBR 15705, pressão de serviço 14BAR/14 kgf/cm3/199 psi de 1 1/4"
    2Unidade
    Produto/Serviço: Registro Pressão
    Descrição: Registro Pressão fabricado em bronze com acabamento bruto, volante fabricado em aluminio com acabamento em pintura epoxi, deve possuir vedação ao longo do eixo com anel oring., sistema de acionamento rotativo, vedação interna com borracha nitrilica e haste não ascendente, deve funcionar perfeitamente em sistema de agua fria e quente, fabricado em conformidade com a norma NBR 15704, pressão de sevrviço 14 bar/14 kgt/cm3 199 pdi fr 1/2"
    25Peça
    Produto/Serviço: Adesivo
    Descrição: Adesivo plastico para PVC, frasco com 175 gr com pincel aplicador, deve atender as especificçaões da Associação Brasileira de Normas }Tecnicas, ter validade minima de 12 meses e data de fabricação inferior a 30 dias
    5Peça
    Produto/Serviço: Solução limpadora para pVC
    Descrição: Solução limpadora para PVC, frasco com 200 cm3, fabricante deve atender as especificçaões da ABNT e ter validade minima de 12 meses, e deve ser entregue comd ata de fabricação inferior a 30 dias
    5Unidade
    Produto/Serviço: Fita Veda Rosca
    Descrição: Fita Veda Rosca 100% PTFE para tubos roscáveis, rolo com as seguintes dimensões 18mm x 50m, fabricado conforme normas ABNT, deve ter 0,07 mm de espessura, com afastamento máximo de 0,02 mm, deve ser resistente a ácidos, bases, solventes, combustíveis, lubrificantes, vapor e fluidos utilizados em processos industriais
    5Unidade
    Produto/Serviço: Tubo de PVC rigido
    Descrição: Tubo de PVC rigido para água fria (peça com 6m), soldavel 25 mm
    45Unidade
    Produto/Serviço: Adaptador soldavel para registro em PVC
    Descrição: Adaptador soldavel para registro em PVC soldavel de 25 x 3/4"
    60Unidade
    Produto/Serviço: Adaptador soldavel para registro em PVC
    Descrição: Adaptador soldavel para registro em PVC soldável de 32 x 1"
    10Unidade
    Produto/Serviço: Adaptador soldavel para registro em PVC
    Descrição: Adaptador soldavel para registro em PVC de 40 x 1 1/4"
    10Unidade
    Produto/Serviço: Adaptador soldavel para registro em PVC
    Descrição: Adaptador soldavel para registro em PVC soldavel de 50 x 1 1/2"
    10Unidade
    Produto/Serviço: Bucha de redução soldavel curta PVC
    Descrição: Bucha de redução soldável curta PVC de 32mm x 25mm
    20Unidade
    Produto/Serviço: Bucha de redução soldavel curta PVC
    Descrição: Bucha de redução soldável curta PVC de 40mm x 32mm
    20Unidade
    Produto/Serviço: Bucha de redução soldavel curta PVC
    Descrição: Bucha de redução soldável curta PVC de 50mm x 40mm
    10Unidade
    Produto/Serviço: Joelho 45o PVC soldavel
    Descrição: Joelho 45o PVC soldavel 25 mm
    100Unidade
    Produto/Serviço: Joelho 45o PVC soldavel
    Descrição: Joelho 45o PVC soldavel 32 mm
    20Unidade
    Produto/Serviço: Joelho 45o PVC soldavel
    Descrição: Joelho 45o PVC soldavel 40 mm
    4Unidade
    Produto/Serviço: Joelho 90o PVC soldavel
    Descrição: Joelho 90o PVC soldável 25mm
    100Unidade
    Produto/Serviço: Joelho 90o PVC soldavel
    Descrição: Joelho 90o PVC soldável 32 mm
    20Unidade
    Produto/Serviço: Joelho 90o PVC soldavel
    Descrição: Joelho 90o PVC soldável 40 mm
    4Unidade
    Produto/Serviço: Luva PVC soldavel
    Descrição: Luva PVC soldavel 25 mm
    100Unidade
    Produto/Serviço: Luva PVC soldavel
    Descrição: Luva PVC soldavel 32mm
    20Unidade
    Produto/Serviço: Luva PVC soldavel
    Descrição: Luva PVC soldavel 40 mm
    10Unidade
    Produto/Serviço: Luva PVC soldavel
    Descrição: Luva PVC soldavel 50 mm
    4Unidade
    Produto/Serviço: Luva de correr para tubo soldavel PVC com anel de borracha
    Descrição: Luva de correr para tubo soldavel PVC com anel de borracha de 40 mm
    4Unidade
    Produto/Serviço: Luva de correr para tubo soldavel PVC com anel de borracha
    Descrição: Luva de correr para tubo soldavel PVC com anel de borracha de 50 mm
    4Unidade
    Produto/Serviço: Te 90o PVC soldavel
    Descrição: Te 90o PVC soldavel de 25mm
    50Unidade
    Produto/Serviço: Te 90o PVC soldavel
    Descrição: Te 90o PVC soldavel 32 mm
    20Unidade
    Produto/Serviço: Te 90o PVC soldavel
    Descrição: Te 90o PVC soldavel 40 mm
    6Unidade
    Produto/Serviço: Te 90o PVC soldavel
    Descrição: Te 90o PVC soldavel 50 mm
    4Unidade
    Produto/Serviço: Te de redução PVC soldavel
    Descrição: Te de redução PVC soldavel 32mm x 25mm
    20Unidade
    Produto/Serviço: Te de redução PVC soldavel
    Descrição: Te de redução PVC soldavel 40mmx25mm
    20Unidade
    Produto/Serviço: Te de redução PVC soldavel
    Descrição: Te de redução PVC soldavel 40mmx32mm
    10Unidade
    Produto/Serviço: Joelho 90o PVC soldavel com bucha latão
    Descrição: Joelho 90o PVC soldavel com bucha latão 25 x 1/2"
    10Unidade
    Produto/Serviço: Luva PVC soldavel com bucha latão
    Descrição: Luva de PVC soldavel com bucha de latão 25 x 1/2"
    30Unidade


    26623/2014
    22/09/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: serviço de confecção de banner
    Descrição: serviço de confecção de banner
    15Unidade


    26626/2014
    22/09/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: primers
    Descrição: primers, conforme descrição: marca: IDT BarbeeF – CAACAAATCATAAAAATATTGG CO1-2166F – GGAGGATTTGGTAATTTTTTAATTCC CO1-2338F – CATATTTATATCATTCATCTCC CO1-2248R – CAAAATCTAATATTATTTATTCG CO1-2386R – GAAAAAATTGTAAAATCAAC MtD9 – CCCGGTAAAATTAAAATATAAACTTC FISHCOILBC_ts - CACGACGTTGTAAAACGACTCAACYAATCAYAAAGATATYGGCAC FISHCOIHBC_ts - GGATAACAATTTCACACAGGACTTCYGGGTGRCCRAARAATCA M13F (-29) - CACGACGTTGTAAAACGAC M13R - GGATAACAATTTCACACAGG
    10Unidade


    26628/2014
    22/09/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Papel Toalha 23 x 21 branco (Official)
    Descrição: Papel Toalha 23 x 21 branco (Official)
    100Caixa


    26633/2014
    22/09/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Cloreto de Cálcio Dihidratado PA/ACS
    Descrição: Cloreto de Cálcio Dihidratado PA/ACS - 0500 gr - Synth
    1Frasco


    26900/2014
    22/09/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: Passagem aérea Clenize das Graças Coelho Resende-CPF: 53943996620-RG: M3252518-TRECHO- UBERLANDIA/BELO HORIZONTE/UBERLANDIA-IDA-18/09/2014-VOO-1667-GOL-14:00HS - VOLTA-20/09/2014-VOO-JJ-3219-TAM AS 16:14HS
    1Unidade