ÁREA DO FORNECEDOR

ACESSO RESTRITO








Conheça aqui os critérios utilizados na concepção e operacionalização deste Portal.

Clique aqui e saiba como fazer seu cadastro no Portal do Fornecedor.

Conheça aqui a Política do Fornecedor.


Destaques


A FEPMVZ recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
    26564/2014
    12/12/2015 00:00:00
    Dispensa de licitação Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: serviço
    Descrição: - PRESTAÇÃO DE SERVIÇO DE PERFURAÇÃO DE (02) DOIS POÇOS DE 80m e 90m, instalação, realização de teste de vazão, fornecimento e instalações de quadro de comando elétrico e conjunto moto-bomba submersa para poço tubular profundo a ser instalado, no terreno do Exercito Brasileiro do RJ na Vila Militar em Deodoro-RJ, utilização de Mão de Obra especializada e equipamentos, e deverá ter sede ou escritório no Rio de Janeiro, sendo; * Será obrigatória a visita ao local por parte dos licitantes interessados, antes da apresentação de suas propostas. Os licitantes interessados deverão fazê-lo para conhecer as condições, assim como, coletar informações, dados e elementos que possam vir a ter influência no desenvolvimento dos trabalhos, de modo que não serão atendidas solicitações durante os serviços, sob o argumento de falta de conhecimento das condições de trabalho ou de dados da especificação, sendo que a mesma será agendado para o dia 07de agosto de 2014 Agnaldo, Tel: 021- 97662-7796 . Após a visita técnica será emitido pelo responsável o Atestado de visita técnica que deverá integrar obrigatoriamente o site licitacoes-e.com.br.
    2Unidade


    37872/2014
    31/01/2015 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Creatina quinase total
    Descrição: Kit de creatina quinase TOTAL (para 100 amostras) da marca Siemens para aparelho de quimioluminescência
    1Kit
    Produto/Serviço: CK-MB
    Descrição: Kit de creatina quinase FRAÇÃO MB (para 100 amostras) da marca Siemens para aparelho de quimioluminescência
    1Kit
    Produto/Serviço: TROPONINA
    Descrição: Kit de TROPONINA (para 100 amostras) da marca Siemens para aparelho de quimioluminescência
    1Kit


    520/2015
    06/02/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: COLETOR DE URINA SISTEMA ABERTO – TIPO GARRAFA
    Descrição: COLETOR DE URINA EM POLIETILENO DE ALTA DENSIDADE, TRANSLÚCIDO, COM CAPACIDADE DE 1200 ML GRADUADA COM ESCALA DE 100 ML, TUBO EXTENSOR EM PVC COM RETENTOR GOTEJADOR NA EXTREMIDADE DISTAL E ADAPTADOR COM TAMPA NA EXTREMIDADE PROXIMAL, ALÇA PLÁSTICA PARA MOVIMENTAÇÃO E FIXAÇÃO, CONTENDO OS DADOS IMPRESSOS DE IDENTIFICAÇÃO, LOTE, DATA DE FABRICAÇÃO E VALIDADE. QUANTIDADE: 100 UNIDADES. ENTREGA PARCELADA: 1ª JANEIRO DE 2015 (50 UNIDADES) 2ª FEVEREIRO DE 2015 (50 UNIDADES)
    100Unidade
    Produto/Serviço: LUVA CIRÚRUGICA Nº 6,5
    Descrição: LUVA CIRÚRGICA ESTÉRIL, DESCARTÁVEL, LÁTEX NATURAL, ANATÔMICA, TEXTURA HOMOGÊNEA, ALTA SENSIBILIDADE AO TATO, BOA ELASTICIDADE. LUBRIFICADA COM PÓ BIOABSORVÍVEL E BAIXO TEOR DE PROTEÍNA (PREFERÊNCIA MENOR QUE 100 ?G/GRAMA) E ANTIDERRAPANTE. ACONDICIONADA EM INVÓLUCRO INTERNO COM DOBRAS PARA ABERTURA ASSÉPTICA, DOBRADAS CONFORME PADRÃO HOSPITALAR, IDENTIFICANDO COM FÁCIL VISUALIZAÇÃO A MÃO ESQUERDA/DIREITA E A POSIÇÃO DO POLEGAR. EMBALADA EM PAPEL GRAU CIRÚRGICO E/OU FILME TERMOPLÁSTICO Nº 6,5. EMBALAGEM UNITÁRIA CONTENDO NÚMERO DO LOTE; DATA DE FABRICAÇÃO E DATA DE VALIDADE. REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO. MARCAS SUGERIDAS: NEW HAND – LEMGRUBER; MADEITEX; SENSITEX - MUCAMBO. QUANTIDADE: 400 PARES DE LUVAS. ENTREGA PARCELADA 1ª JANEIRO DE 2015 (200 PARES) 2ª FEVEREIRO DE 2015 (200 PARES)
    400Caixa
    Produto/Serviço: LUVA CIRÚRUGICA Nº 7,0
    Descrição: LUVA CIRÚRGICA ESTÉRIL, DESCARTÁVEL, LÁTEX NATURAL, ANATÔMICA, TEXTURA HOMOGÊNEA, ALTA SENSIBILIDADE AO TATO, BOA ELASTICIDADE. LUBRIFICADA COM PÓ BIOABSORVÍVEL E BAIXO TEOR DE PROTEÍNA (PREFERÊNCIA MENOR QUE 100 ?G/GRAMA) E ANTIDERRAPANTE. ACONDICIONADA EM INVÓLUCRO INTERNO COM DOBRAS PARA ABERTURA ASSÉPTICA, DOBRADAS CONFORME PADRÃO HOSPITALAR, IDENTIFICANDO COM FÁCIL VISUALIZAÇÃO A MÃO ESQUERDA/DIREITA E A POSIÇÃO DO POLEGAR. EMBALADA EM PAPEL GRAU CIRÚRGICO E/OU FILME TERMOPLÁSTICO Nº 7,0. EMBALAGEM UNITÁRIA CONTENDO NÚMERO DO LOTE; DATA DE FABRICAÇÃO E DATA DE VALIDADE. REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO. MARCAS SUGERIDAS: NEW HAND – LEMGRUBER; MADEITEX; SENSITEX - MUCAMBO QUANTIDADE: 400 PARES DE LUVAS ENTREGA PARCELADA 1ª JANEIRO DE 2015 (200 PARES) 2ª FEVEREIRO DE 2015 (200 PARES)
    400Caixa
    Produto/Serviço: LUVA CIRÚRUGICA Nº 7,5
    Descrição: LUVA CIRÚRGICA ESTÉRIL, DESCARTÁVEL, LÁTEX NATURAL, ANATÔMICA, TEXTURA HOMOGÊNEA, ALTA SENSIBILIDADE AO TATO, BOA ELASTICIDADE. LUBRIFICADA COM PÓ BIOABSORVÍVEL E BAIXO TEOR DE PROTEÍNA (PREFERÊNCIA MENOR QUE 100 ?G/GRAMA) E ANTIDERRAPANTE. ACONDICIONADA EM INVÓLUCRO INTERNO COM DOBRAS PARA ABERTURA ASSÉPTICA, DOBRADAS CONFORME PADRÃO HOSPITALAR, IDENTIFICANDO COM FÁCIL VISUALIZAÇÃO A MÃO ESQUERDA/DIREITA E A POSIÇÃO DO POLEGAR. EMBALADA EM PAPEL GRAU CIRÚRGICO E/OU FILME TERMOPLÁSTICO Nº 7,5. EMBALAGEM UNITÁRIA CONTENDO NÚMERO DO LOTE; DATA DE FABRICAÇÃO E DATA DE VALIDADE. REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO. MARCAS SUGERIDAS: NEW HAND – LEMGRUBER; MADEITEX; SENSITEX - MUCAMBO QUANTIDADE: 200 PARES DE LUVAS
    200Caixa
    Produto/Serviço: LUVA DE PROCEDIMENTO TAMANHO GRANDE - CAIXA COM 100 UNIDADES.
    Descrição: LUVA DE PROCEDIMENTO, NÃO ESTÉRIL, DESCARTÁVEL, 100% LÁTEX NATURAL, ANATÔMICA, TEXTURA HOMOGÊNEA, ALTA SENSIBILIDADE AO TATO, BOA ELASTICIDADE E RESISTENTE À TRAÇÃO, AMBIDESTRA, COMPRIMENTO MÍNIMO DE 25 CM, LUBRIFICADA COM PÓ BIOABSORVÍVEL, BAIXO TEOR DE PROTEÍNAS. ACONDICIONADA EM CAIXA COM 100 UNIDADES. CONTENDO OS DADOS IMPRESSOS DE IDENTIFICAÇÃO, LOTE, DATA DE FABRICAÇÃO E VALIDADE E REGISTRO ANVISA. TAMANHO G. QUANTIDADE: 10 CAIXAS COM 100 UNIDADES.
    10Caixa
    Produto/Serviço: MASCARA CIRÚRGICA DESCARTÁVEL - PACOTE COM 100 UNIDADES
    Descrição: MASCARA CIRÚRGICA DESCARTÁVEL COM 03 CAMADAS; DE NÃO TECIDO; COMPLEMENTO: CONFECCIONADA COM 02 CAMADAS DE NÃO-TECIDO, UMA CAMADA DE FILTRO BACTERIANO, MODELO RETANGULAR, COM PREGAS LONGITUDINAIS, DISPOSITIVO PARA AJUSTE NASAL, 4 TIRAS LATERAIS, INODORA, ATÓXICA E HIPOALERGÊNICA, GRAMATURA TOTAL 40GRS/M². QUANTIDADE: 50 PACOTES COM 100 UNIDADES CADA.
    50Unidade
    Produto/Serviço: TAMPA OCLUSORA MACHO-FEMEA
    Descrição: TAMPA PARA INJEÇÃO; TAMPA OCLUSORA SEGURA COM PONTO DE INJEÇÃO; COM MEMBRANA FLEXÍVEL LIVRE DE LÁTEX QUE PERMITE ADMINISTRAÇÃO INTERMITENTE DE MEDICAMENTOS; CONEXÃO LUER LOCK MACHO. USO DESCARTÁVEL, ESTÉRIL. EMBALAGEM UNITÁRIA CONTENDO NÚMERO DO LOTE; DATA DE FABRICAÇÃO E DATA DE VALIDADE. REGISTRO NA ANVISA. QUANTIDADE: TOTAL DE 1.000 UNIDADES DA TAMPA OCLUSORA MACHO-FEMEA. ENTREGA PARCELADA 1ª JANEIRO DE 2015 (900 UNIDADES) 2ª FEVEREIRO DE 2015 (900 UNIDADES)
    1800Unidade
    Produto/Serviço: TOUCA/GORRO CIRÚRGICO DESCARTÁVEL - PACOTE COM 100 UNIDADES
    Descrição: TOUCA/GORRO CIRÚRGICO DESCARTÁVEL, BRANCA, CONFECCIONADO COM MATERIAL DE FIBRA SINTÉTICA, FORMATO ANATÔMICO, COM TIRAS,COM GRAMATURA DE 30, CONTENDO OS DADOS IMPRESSOS DE IDENTIFICAÇÃO, LOTE, DATA DE FABRICAÇÃO E VALIDADE. QUANTIDADE: 15 PACOTES COM 100 UNIDADES CADA.
    15Unidade
    Produto/Serviço: ESPARADRAPO 10 CM X 4,5 M
    Descrição: ESPARADRAPO IMPERMEÁVEL, COM BOA ADERÊNCIA, HIPOALÉRGICO, COM DORSO EM TECIDO DE ALGODÃO NA COR BRANCA. ROLO COM 10 CM X 4,5 M. CONTENDO OS DADOS IMPRESSOS DE IDENTIFICAÇÃO, LOTE, DATA DE FABRICAÇÃO E VALIDADE. REGISTRO. QUANTIDADE: 240 ROLOS. ENTREGA PARCELADA 1ª JANEIRO DE 2015 (144 ROLOS) 2ª FEVEREIRO DE 2015 (96 ROLOS)
    240Frasco


    2371/2015
    30/01/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Kit Amônia tóxica água doce (Labcon test) 50 amostras
    Descrição: Kit de amônia para análise de água * Kit Amônia tóxica água doce (Labcon test) 50 amostras
    5Kit


    2385/2015
    17/03/2015 16:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 002/2015 Vaga para o cargo medico Veterinário - Salario: R$4.223,33, Contrato horista aproximadamente 45Hs semanais.
    1Unidade


    2386/2015
    06/03/2015 16:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 001/2015 Vaga para o cargo Medico Veterinário - Salario: R$4.998,85, Contrato horista aproximadamente 40Hs semanais. Experiencia em atendimento em clinica medica e em patologia clinica cirurgica
    1Unidade


    2971/2015
    30/01/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: LS 004177 COLLAGENASE TYPE 2 (CLS - 2)
    Descrição: LS 004177- 5G - WORTHINGTON COLLAGENASE TYPE 2 (CLS - 2)
    5Grama
    Produto/Serviço: ACIDO TRICLOROACETICO
    Descrição: ÁCIDO TRICLOROACETICO
    2Quilograma


    2972/2015
    28/01/2015 16:00:00
    Cotação Eletrônica Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Chapa de isopor com espessura de 30mm, largura de 500mm e comprimento de 1000mm, densidade de 13 kg
    Descrição: Chapa de isopor com espessura de 30mm, largura de 500mm e comprimento de 1000mm, densidade de 13 kg
    24Unidade


    2996/2015
    28/01/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Kit de filtração de fase móvel, Marca Phox cat n° 25005
    Descrição: Kit de filtração de fase móvel Marca: Phox Modelo: - Part number: 25005 Especificações: Sistema de filtração totalmente em vidro (all glass) p/ líquidos aquosos, orgânicos ou corrosivos p/ análise de contaminação por particulados e solventes p/ hplc, 47mm de diâmetro, composto de funil 300ml, base com tampa tubulada, erlenmeyer 1000ml e garra - Quantidade: 1 unidade
    1Kit


    3395/2015
    28/01/2015 16:00:00
    Cotação Eletrônica Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Folder Jovem Salva Vidas
    Descrição: Folder Jovem Salva Vidas • Papel couchê, formato 21x29,7cm (A4), com 120g, 4/4 cor tinta escala Patone (CMYK) e acabamento em corte reto/simples e dobra. Fotolito/CTP. • Prova impressa, conf. Termo de Referência
    5000Unidade
    Produto/Serviço: Cartaz - Jovem Salva Vidas
    Descrição: Cartaz Jovem Salva Vidas • Papel off-set branco, formato 29,7X42cm (A3), com 150g, 4/0 cor - corte simples . Fotolito/CTP. • Prova impressa. Conf. Termo de Referência.
    500Unidade
    Produto/Serviço: Revista: PJSV
    Descrição: Revista PJSV Formato: • Aberto - 21x30cm • Fechado - 21x15cm (A5 Papel: • Capa - Couché brilho 150g/m2 • Miolo - Off-set 90g/m2 Cor: • Capa: 4/4 •Miolo – 4/4 Acabamento: • Corte simples, alceamento, dobra, grampo canoa
    1000Unidade
    Produto/Serviço: Revista: Guia do Educador
    Descrição: Guia do Educador Formato: • Aberto - 21x30cm • Fechado - 21x15cm (A5) Papel: • Capa - Couché brilho 150g/m2 • Miolo - Off-set 90g/m2 Cor: • Capa - 4/4 • Miolo - 4/4 Acabamento: • Corte simples, alceamento, dobra, grampo canoa
    1000Unidade
    Produto/Serviço: Revista: Atenção às Crianças e Adolescentes com Doença Falciforme na Escola - Guia para Professores
    Descrição: Atenção às Crianças e Adolescentes com Doença Falciforme na Escola - Guia para Professores Formato: Formato aberto - 21x30cm Formato fechado - 21x15cm Capa - papel couché brilho 150g Miolo - papel couché brilho 90g Cor - Capa 4/0 Miolo 4/4 Acabamento: Uma dobra, grampo canoa Total de páginas – 24 ( 6 lâminas A4 frente/verso) OBS: As ARTES para confecção do material dererão ser retiradas no Nupad com Belini 3409-8966.
    1000Unidade


    3684/2015
    01/02/2015 16:00:00
    Dispensa de licitação Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Manutencao de ultrafreezer Revco e troca de compressor
    Descrição: Manutencao de ultrafreezer Revco e troca de compressor
    1Unidade


    3756/2015
    31/01/2015 16:00:00
    Cotação Eletrônica Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: BLEOMICINA,SULFATO 15 UI - PÓ LIOFILIZADO
    Descrição: BLEOMICINA,SULFATO 15 UI - PÓ LIOFILIZADO MEDICAMENTO ONCOLÓGICO. REGISTRO. VALIDADE SUPERIOR A UM ANO. QUANTIDADE: 20 FRASCOS/UNIDADES
    20Unidade
    Produto/Serviço: MITOXANTRONA CLORIDRATO 20 MG - 2MG/ML FRASCO
    Descrição: MITOXANTRONA CLORIDRATO 20 MG - 2MG/ML FRASCO MEDICAMENTO ONCOLÓGICO. REGISTRO. VALIDADE SUPERIOR A UM ANO. QUANTIDADE: 01 FRASCO/UNIDADE
    1Unidade
    Produto/Serviço: CARBOPLATINA 150MG/15ML FRASCO-AMPOLA COM 15ML.
    Descrição: CARBOPLATINA 150MG/15ML FRASCO-AMPOLA COM 15ML. (DILUÍDA). MEDICAMENTO ONCOLÓGICO. REGISTRO. VALIDADE SUPERIOR A UM ANO. QUANTIDADE: 30 FRASCOS/UNIDADES
    30Unidade
    Produto/Serviço: doxorrubicina
    Descrição: DOXORRUBICINA,CLORIDRATO 10MG-PO LIOFILIZADO FRASCO-AMPOLA. MEDICAMENTO ONCOLÓGICO. REGISTRO. VALIDADE SUPERIOR A UM ANO. QUANTIDADE: 15 CAIXAS/FRASCOS.
    15Caixa


    3757/2015
    31/01/2015 16:00:00
    Cotação Eletrônica Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: SORO FISIOLÓGICO 0,9% FRASCO RÍGIDO COM 1000 ML
    Descrição: SORO FISIOLÓGICO 0,9% FRASCO RÍGIDO COM 1000 ML EDITAL 04/2014 - 534935 - PREGÃO ELETRÔNICO. VALIDADE SUPERIOR A UM ANO. REGISTRO. QUANTIDADE: 240 FRASCOS/UNIDADES
    240Unidade
    Produto/Serviço: SOLUÇÃO DE BICARBONATO DE SÓDIO
    Descrição: SOLUÇÃO DE BICARBONATO DE SÓDIO 8,4% - FRASCO C/ 250 ML VALIDADE SUPERIOR A UM ANO. REGISTRO. QUANTIDADE: 48 FRASCOS/UNIDADES
    48Frasco
    Produto/Serviço: SORO RINGER SIMPLES FRASCO COM 500 ML
    Descrição: SORO RINGER SIMPLES FRASCO COM 500 ML FRASCO RÍGIDO. SOLUÇÃO ESTÉRIL. VALIDADE SUPERIOR A UM ANO. REGISTRO. MARCAS DE REFERÊNCIA: FRESENIUS/BBRAUN QUANTIDADE: 30 FRASCOS/UNIDADES
    30Unidade


    3758/2015
    31/01/2015 16:00:00
    Cotação Eletrônica Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Alérgenos - Intradérmicos
    Descrição: 01 frasco de cada - cada com 02 ml Ácaros • Blomia tropicalis • Dermatophagoides farinae • Dermatophagoides pteronyssinus Fungos • Alternaria alternata • Aspergilus fumigatus • Penicillium notatum (var. crhysogenum) Gramíneas • Cynodon dactylon (Grama Comum ou das Bermudas) • Dactylis glomerata (Grama Rhodes) • Paspalum notatum (Capim de Pasto ou Grama Batatais) Epitélios • Epitélio de Carneiro (Lã) • Epitélio de Gato • Penas de Pombo Insetos • Blatella germanica (Barata da Cozinha) • Periplaneta americana (Barata do Esgoto) • Culex sp Controles • Controle positivo • Controle negativo
    17Unidade


    3803/2015
    31/01/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Análises
    Descrição: valor de R$1240,00 740955.50 - MACHEREY NAGEL NUCLEOSPIN RNA® COLUMNS WITH COLLECTION TUBES, COLLECTION TUBES (2 ML), COLLECTION TUBES (1.5 ML), NUCLEOSPIN® FILTERS, BUFFERS, RNASE-FREE RDNASE
    1Kit


    3804/2015
    31/01/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Pré filtro com elemento com conexão de 1/2
    Descrição: Pré filtro com elemento com conexão de 1/2
    1Unidade
    Produto/Serviço: mão francesa de 200x150
    Descrição: mão francesa de 200x150
    2Unidade
    Produto/Serviço: mangueira trançado de 1/2
    Descrição: mangueira trançado de 1/2
    10Unidade
    Produto/Serviço: mangote aramado de aço inox de 1-1/2x700mm macho e fêmea com anel de vedação
    Descrição: mangote aramado de aço inox de 1-1/2x700mm macho e fêmea com anel de vedação
    1Unidade
    Produto/Serviço: registro de fecho rápido de 1/2
    Descrição: registro de fecho rápido de 1/2
    2Unidade
    Produto/Serviço: joelho de 1/2 de latão ou bronze
    Descrição: joelho de 1/2 de latão ou bronze
    5Unidade
    Produto/Serviço: niple de 1/2 latão ou bronze
    Descrição: niple de 1/2 latão ou bronze
    5Unidade
    Produto/Serviço: tê de 1/2
    Descrição: tê de 1/2
    2Unidade
    Produto/Serviço: joelho de 1-1/2 galvanizado
    Descrição: joelho de 1-1/2 galvanizado
    1Unidade
    Produto/Serviço: niple de 1-1/2 galvanizado
    Descrição: niple de 1-1/2 galvanizado
    2Unidade
    Produto/Serviço: veda risca de 3/4x50m
    Descrição: veda risca de 3/4x50m
    2Unidade
    Produto/Serviço: ispigao de 1/2x3/8
    Descrição: ispigao de 1/2x3/8
    4Unidade
    Produto/Serviço: conjunto lubrifil com conexão de 1/4
    Descrição: conjunto lubrifil com conexão de 1/4
    1Unidade
    Produto/Serviço: registro de fecho rápido de 1/4
    Descrição: registro de fecho rápido de 1/4
    1Unidade
    Produto/Serviço: mangueira de 1/4 poliflor ou nailon
    Descrição: mangueira de 1/4 poliflor ou nailon
    2Unidade
    Produto/Serviço: joelho de rosca de 1/4 com saída pra mangueira de 1/4 com pressão
    Descrição: joelho de rosca de 1/4 com saída pra mangueira de 1/4 com pressão
    2Unidade
    Produto/Serviço: conexão reta com rosca de 1/4 com saída pra mangueira de 1/4 com pressão
    Descrição: conexão reta com rosca de 1/4 com saída pra mangueira de 1/4 com pressão
    2Unidade


    3914/2015
    01/02/2015 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: Passagem aérea nacional para: Prof. Jairo Jaramillo Cardenas. Ida: 09/02/2015 AZUL - AD 2440, Saída São Paulo Campinas - 07:00 Chegada Belo Horizonte Pampulha - 08:35 Volta: 09/02/2015 AZUL AD 4187, Saída: Belo Horizonte - Confins 21:04 Chegada São Paulo - Campinas 22:17
    2Unidade


    3918/2015
    01/02/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Oligonucleotídeo aopB sense, Escala 25 nmol
    Descrição: Oligonucleotídeo aopB sense, Escala 25 nmol Sequência: 5' TACCTGTTGGAATGATTCCG 3' Escala: 25 nmol
    1Unidade
    Produto/Serviço: Oligonucleotídeo aopB anti-sense, Escala 25 nmol
    Descrição: Oligonucleotídeo aopB anti-sense, Escala 25 nmol Sequência: 5' AGTGAACGCCCTCTCTCC 3' Escala: 25 nmol
    1Unidade