ÁREA DO FORNECEDOR

ACESSO RESTRITO








Conheça aqui os critérios utilizados na concepção e operacionalização deste Portal.

Clique aqui e saiba como fazer seu cadastro no Portal do Fornecedor.

Conheça aqui a Política do Fornecedor.


Destaques


A FEPMVZ recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
    23269/2013
    03/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Metanol PA
    Descrição: Metanol PA
    10Caixa
    Produto/Serviço: Acetonitrila
    Descrição: Acetonitrila PA
    10Litro
    Produto/Serviço: ácido fórmico
    Descrição: ácido fórmico PA, pureza > 98-100% marca Sigma cod F0507
    1Litro
    Produto/Serviço: solução aquosa de Amônia
    Descrição: solução aquosa de Amônia 28-30%, grau ACS, marca Sigma, cod.320145
    1Litro
    Produto/Serviço: ácido acético glacial 100%
    Descrição: ácido acético glacial 100% grau ACS, marca Sigma, cod A6583
    1Frasco Âmbbar
    Produto/Serviço: acetona P.A
    Descrição: acetona grau HPLC Plus, pureza >99,9% - marca Sigma cod 650501
    1Litro
    Produto/Serviço: metanol UV/HPLC
    Descrição: metanol grau UV/HPLC pureza >99,9%
    4Litro
    Produto/Serviço: Acetonitrila UV/HPLC
    Descrição: Acetonitrila UV/HPLC pureza >99,9% marca Sigma cod 34998
    4Litro
    Produto/Serviço: Acetonitrila UPLC/LC-MS
    Descrição: Acetonitrila UPLC/LC-MS pureza >99,9%, filtração de partículas 0,2um, livre de compostos não voláteis, níveis muito baixos de íons inorgânicos e metais (max.50ppb). marca Sigma - código 34967 Duvidas neste produto: falar c/ profa. Kelly tel. 85854965 ou ramal: 2088/2115
    9,5Litro
    Produto/Serviço: metanol UPLC/LC-MS
    Descrição: metanol UPLC/LC-MS, pureza >99,9% filtração de particulas 0,2um, livre de compostos não volateis, níveis muito baixos de íons inorganicos e metais (máx 50ppb), marca Sigma, cod 34860
    10Litro
    Produto/Serviço: Acetato de Etila UPCL/LC-MS
    Descrição: Acetato de Etila UPCL/LC-MS pureza >99,9%, filtração de particulas 0,2um, livre de compostos não voláteis , níveis muito baixos de ions organicos e metais (max.50ppb), marca sigma, cod 34972
    5Litro
    Produto/Serviço: Água ultra pura
    Descrição: Água grau LC-MS, filtração de particulas 0,2um, livre de compostos não voláteis , níveis muito baixos de ions organicos e metais (max.50ppb), marca sigma, cod. 39253
    20Litro
    Produto/Serviço: isopropanol HPLC/LC-MS
    Descrição: isopropanol HPLC/LC-MS pureza >99,9%, marca sigma, cod 34965
    5Frasco


    2065/2014
    31/12/2014 00:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física para Tutor de ensino a distancia
    3Unidade


    2726/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física Edital 002/2014 - Secretaria
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Analista de Sistemas Junior
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Enfermeiro
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Analista de Sistemas Pleno
    1Unidade


    2727/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 003/2014 Processo seletivo simplificado - Auxiliar de Projeto
    1Unidade


    2734/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Processo seletivo Edital 004/2014 - Analista I
    1Unidade


    3382/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Processo Seletivo Contratação de Pessoa Física Secretaria Executiva Edital: 006/2014
    1Unidade


    5046/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Auxiliar adminstrativo
    Descrição: Fundação de Estudo e Pesquisa em Medicina Veterinária e Zootecnia - FEPMVZ SOLICITAÇÃO DE REALIZAÇÃO DE PROCESSO SELETIVO Centro de Custo: Projeto: Projeto de manutenção e ampliação do Centro Regional de Referência para formação permanente de profissionais ligados a assistência de familiares e usuários de Crack da Universidade Federal de Minas Gerais no município de Belo Horizonte Coordenador: Frederico Duarte Garcia Contratação: (X) CLT ( ) Prestação de serviço PRE-REQUISITOS PARA A CONTRATAÇAO Função/Serviço: Auxiliar administrativo Salário/Valor: R$2.5000,00 (valor bruto com os encargos patronais) Período: Fevereiro / 2014 a julho de 2015 Forma de Pagamento: mensal/depósito em conta corrente Jornada de Trabalho (CLT): 6 horas diárias e 5 dias por semana Subordinação (CLT): Escolaridade: Nível superior dentro da área de administração, ou saúde, ou reabilitação. Fluente em língua inglesa Experiência: Experiência, em gestão geral e organização de eventos Atribuições: 1. Controle de agenda e compromissos 2. Planejamento de viagens 3. Despacho e conferência de documentos 4. Organização de arquivos 5. Atendimento telefônico 6. Recepção de colaboradores do CRR 7. Planejamento dos cursos e eventos do CRR 8. Atendimento a colaboradores do CRR 9. Organizar planning, redigir atas e súmulas de reuniões. 10. Conferência de documentos 11. Auxiliar no desenvolvimento e organização do CRR 12. Organização dos simpósios do CRR 13. Digitação e diagramação Exigências para desempenho das funções: Vagas: 1 (uma) Outros: Informação Complementar: CRITÉRIO PARA PONTUAÇAO Favor citar a pontuação que deve ser atribuída aos seguintes requisitos: 1 – Experiência Profissional: Serão atribuídos 70 (setenta) pontos na avaliação da experiência profissional e currículo, a qual será avaliada segundo os seguintes quesitos • Histórico de Conclusão do Curso de Graduação • Certificados/Declaração de Conhecimento em Informática • Certificado/Declaração de Curso de Línguas Estrangeiras. Experiência profissional relevante 2 – Prova de Entrevista: Serão atribuídos à entrevista 30 (trinta) pontos. Desta forma, solicito a contratação de pessoa física que atenda os requisitos informados acima. Belo Horizonte, 17/01/2013____ Professor: Frederico Garcia Assinatura:
    1Unidade


    5449/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Abertura de Processo Seletivo Simplificado - Edital 07/2014 Vaga - Assistente de processos R$ 1.600,00
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Abertura de Processo Seletivo Simplificado - Edital 07/2014 - Vaga Assistente Administrativo R$ 1.350,00
    1Unidade


    5938/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física- Edital 009/2014 Abertura de processo seletivo simplificado 01vaga para: Tecnico em Pesquisa R$ 1.200,00 01 vaga para: Epidemiologista R$ 1.500,00
    2Unidade


    5940/2014
    31/12/2014 00:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 005/2014 Abertura de processo seletivo simplificado 01 vaga para: Tecnico de Farmacia R$ 900,00 01 vaga para: Tecnico em Enfermagem R$ 812,36
    2Unidade


    7844/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Processo Seletivo
    Descrição: Edital 011/2014- Abertura de processo seletivo simplificado para contratação de empregados - 02 vagas para auxiliar administrativo R$ 900,00
    2Unidade


    9759/2014
    30/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física- Processo Seletivo 013/2014 Função: Tutor de Ensino a distância.
    1Unidade


    19216/2014
    15/10/2014 00:00:00
    Cotação Eletrônica Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Análises
    Descrição: Análises Niacina As vitaminas deverão ser quantificáveis acima dos seguintes valores: Niacina: 1,00 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises Vitamina B1 (Tiamina) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina B1: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises B2 (Riboflavina) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina B2: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises B6 (PIRIDOXINA) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina B6: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - ácido fólico/folatos As vitaminas deverão ser quantificáveis acima dos seguintes valores: Ácido fólico: 50,00 mcg/100g.
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - Vitamina A As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina A: 5,00 mcg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - Vitamina D As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina D: 5,00 mcg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises Vitamina E (tocoferóis) As vitaminas deverão ser quantificáveis acima dos seguintes valores: Vitamina E: 0,03 mg/100g
    20Unidade
    Produto/Serviço: Análises
    Descrição: Análises - Ácido Ascórbico As vitaminas deverão ser quantificáveis acima dos seguintes valores: Ácido Ascórbico: 1,00 mg/100g
    20Unidade


    23940/2014
    03/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Infertile
    Descrição: Infertile
    400Frasco


    26414/2014
    03/11/2014 00:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Auxiliar de Serviços Gerais Salário - R$ 847,00 + R$ 144,80 = salário + Insalubridade Atribuições: - Auxiliar no cumprimento de atividades ligadas a fazenda e Hospital Veterinário - Auxiliar na fiscalização periódica das dependências internas e externas das Escola e Hospital Veterinário - Carregar e descarregar materiais, moveis e equipamentos diversos - Carregar e descarregar veículos de transportes
    1Unidade


    26564/2014
    31/12/2014 00:00:00
    Dispensa de licitação Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: serviço
    Descrição: - PRESTAÇÃO DE SERVIÇO DE PERFURAÇÃO DE (02) DOIS POÇOS DE 80m e 90m, instalação, realização de teste de vazão, fornecimento e instalações de quadro de comando elétrico e conjunto moto-bomba submersa para poço tubular profundo a ser instalado, no terreno do Exercito Brasileiro do RJ na Vila Militar em Deodoro-RJ, utilização de Mão de Obra especializada e equipamentos, e deverá ter sede ou escritório no Rio de Janeiro, sendo; * Será obrigatória a visita ao local por parte dos licitantes interessados, antes da apresentação de suas propostas. Os licitantes interessados deverão fazê-lo para conhecer as condições, assim como, coletar informações, dados e elementos que possam vir a ter influência no desenvolvimento dos trabalhos, de modo que não serão atendidas solicitações durante os serviços, sob o argumento de falta de conhecimento das condições de trabalho ou de dados da especificação, sendo que a mesma será agendado para o dia 07de agosto de 2014 Agnaldo, Tel: 021- 97662-7796 . Após a visita técnica será emitido pelo responsável o Atestado de visita técnica que deverá integrar obrigatoriamente o site licitacoes-e.com.br.
    2Unidade


    26566/2014
    03/10/2014 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Tubo
    Descrição: Caixas de tubo colorimétrico de Hidrogen Sulfite, modelo 120sf, de 25-200ppm, marca Sensidyne (USA) caixa com 10 ampolas
    5Caixa
    Produto/Serviço: Tubo
    Descrição: 10 caixas de tubo colorimétrico de gás sulfídrico, modelo 120SH, de 0,1 - 4% - marca Sensidyne (USA), caixa com 10 ampolas
    10Caixa


    26625/2014
    03/10/2014 00:00:00
    Dispensa de licitação Material de Escritório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: NOBREAK
    Descrição: NOBREAK NHS modelo interactive compact pluss III 1200 preto, bivolt
    1Unidade


    26626/2014
    02/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: primers
    Descrição: primers, conforme descrição: marca: IDT BarbeeF – CAACAAATCATAAAAATATTGG CO1-2166F – GGAGGATTTGGTAATTTTTTAATTCC CO1-2338F – CATATTTATATCATTCATCTCC CO1-2248R – CAAAATCTAATATTATTTATTCG CO1-2386R – GAAAAAATTGTAAAATCAAC MtD9 – CCCGGTAAAATTAAAATATAAACTTC FISHCOILBC_ts - CACGACGTTGTAAAACGACTCAACYAATCAYAAAGATATYGGCAC FISHCOIHBC_ts - GGATAACAATTTCACACAGGACTTCYGGGTGRCCRAARAATCA M13F (-29) - CACGACGTTGTAAAACGAC M13R - GGATAACAATTTCACACAGG
    10Unidade


    27467/2014
    03/10/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Ar condicionado e serviço de instalação de ar condicionado
    Descrição: Fornecimento e assentamento de Split (evaporadora e condensadora ) maior que ou igual a 30.000 BTU`S 220V , selo procel , controle remoto com funções turbo e timer , módulos de refrigeração, aquecimento, ventilação e desumidificação, filtro eletrostático, garantia mínima de 01 ano . Incluso instalação mecânica, fixação externa da condensadora e interna da evaporadora e drenagem.
    1Unidade


    27978/2014
    03/10/2014 00:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: DIPIRONA SÓDICA - 500 MG/ML - AMPOLA COM 2 ML
    Descrição: DIPIRONA SÓDICA - 500 MG/ML - AMPOLA COM 2 ML TOTAL DE 300 AMPOLAS VALIDADE DE NO MÍNIMO 1 ANO. PEDIR CERTIFICADO DE ANÁLISE.
    300Unidade
    Produto/Serviço: CARVÃO ATIVADO - SACHÊ C/ 8 GRAMAS CAIXA COM 10 SACHÊS - ENTEREX
    Descrição: CARVÃO ATIVADO - SACHÊ C/ 8 GRAMAS - ENTEREX TOTAL DE 6 CAIXAS COM 10 SACHÊS VALIDADE DE NO MÍNIMO 1 ANO.
    6Unidade
    Produto/Serviço: gentasil injetável 50ml
    Descrição: GENTAMICINA 40MG/ML - FRASCO COM 50ML. TOTAL DE 6 CAIXAS. VENCIMENTO DE NO MÍNIMO 1 ANO.
    6Caixa


    27996/2014
    03/10/2014 00:00:00
    Dispensa de licitação Produtos Agropecuários
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: BALDE SANITIZANTE PASTILHA
    Descrição: BALDE SANITIZANTE PASTILHA
    1Unidade
    Produto/Serviço: detergente alcalino tripfan
    Descrição: detergente alcalino tripfan Bombona de 20litros
    1Bombona


    28145/2014
    05/10/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Placa de sequenciamento
    Descrição: MICROPLACA DE PCR MEIA BORDA 96 POÇOS TRANSPARENTE. PACOTE COM 10 UNIDADES Para uso em termociclador para PCR - Em polipropileno (PP), com 96 poços de 200µL com meia borda lateral; Identificação alfanumérica; Livre de DNA, DNase, RNase e pirogênio. Compatível com equipamento de Applied Biosystems.
    1Pacote


    28450/2014
    05/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: tubo endotraqueal nº 10
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 10, características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 60 unidades/tubos. Pedir amostra.
    60Unidade
    Produto/Serviço: tubo endotraqueal nº 3,0
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 3,0, características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 60 unidades/tubos. Pedir amostra.
    60Unidade
    Produto/Serviço: tubo endotraqueal nº 4,5
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 4,5, características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 90 unidades/tubos. Pedir amostra.
    90Unidade
    Produto/Serviço: tubo endotraqueal nº 5,0
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 5,0, características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 150 unidades/tubos. Pedir amostra.
    150Unidade
    Produto/Serviço: tubo endotraqueal nº 5,5
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 5,5 ; características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 150 unidades/tubos. Pedir amostra.
    150Unidade
    Produto/Serviço: tubo endotraqueal nº 7,0
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 7,0 ; características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 60 unidades/tubos. Pedir amostra.
    60Unidade
    Produto/Serviço: tubo endotraqueal nº 7,5
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 7,5 ; características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 60 unidades/tubos. Pedir amostra.
    60Unidade
    Produto/Serviço: tubo endotraqueal nº 8,5
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 8,5 ; características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 90 unidades/tubos. Pedir amostra.
    90Unidade
    Produto/Serviço: tubo endotraqueal nº 9,0
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 9,0 ; características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 80 unidades/tubos. Pedir amostra.
    80Unidade
    Produto/Serviço: tubo endotraqueal nº 3,5
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 3,5 ; características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 100 unidades/tubos. Pedir amostra.
    100Unidade
    Produto/Serviço: tubo endotraqueal nº 4,0
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 4,0 ; características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 90 unidades/tubos. Pedir amostra.
    90Unidade
    Produto/Serviço: tubo endotraqueal nº 6,0
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 6,0 ; características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 150 unidades/tubos. Pedir amostra.
    150Unidade
    Produto/Serviço: tubo endotraqueal nº 6,5
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 6,5 ; características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 120 unidades/tubos. Pedir amostra.
    120Unidade
    Produto/Serviço: tubo endotraqueal nº 8,0
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 8,0 ; características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 90 unidades/tubos. Pedir amostra.
    90Unidade
    Produto/Serviço: tubo endotraqueal nº 9,5
    Descrição: Tubo endotraqueal, material PVC siliconizado atóxico, tamanho 9,5 ; características adicionais marcador radiopaco, tipo c/ balão, transmitância transparente, componentes orifício lateral de murphy, uso descartável, estéril. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA. Validade de no mínimo 1 ano. Caixa com 10 unidades. Total de 30 unidades/tubos. Pedir amostra.
    30Unidade


    28454/2014
    04/10/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Sonda gástrica longa Nº: 06.
    Descrição: Sonda gástrica, descartável, atóxica, esterilizada, em PVC flexível, transparente, atraumática, com orifícios laterais, tipo Levine, longa Nº 06. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Embalagem com 10 unidades. Total 120 unidades/sondas. Pedir amostra.
    120Unidade
    Produto/Serviço: Sonda gástrica longa Nº: 08
    Descrição: Sonda gástrica, descartável, atóxica, esterilizada, em PVC flexível, transparente, atraumática, com orifícios laterais, tipo Levine, longa Nº: 08. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Embalagem com 10 unidades. Total 150 unidades/sondas. Pedir amostra.
    150Unidade
    Produto/Serviço: Sonda gástrica longa Nº: 20
    Descrição: Sonda gástrica, descartável, atóxica, esterilizada, em PVC flexível, transparente, atraumática, com orifícios laterais, tipo Levine, longa Nº: 20. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Embalagem com 10 unidades. Total 10 unidades/sondas. Pedir amostra.
    10Unidade
    Produto/Serviço: Sonda gástrica longa Nº: 24.
    Descrição: Sonda gástrica, descartável, atóxica, esterilizada, em PVC flexível, transparente, atraumática, com orifícios laterais, tipo Levine, longa Nº: 24. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Embalagem com 10 unidades. Total 10 unidades/sondas. Pedir amostra.
    10Unidade
    Produto/Serviço: Sonda gástrica longa Nº: 12
    Descrição: Sonda gástrica, descartável, atóxica, esterilizada, em PVC flexível, transparente, atraumática, com orifícios laterais, tipo Levine, longa Nº: 12. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Embalagem com 10 unidades. Total de 20 unidades/sondas. Pedir amostra.
    20Unidade
    Produto/Serviço: Sonda gástrica longa Nº: 10
    Descrição: Sonda gástrica, descartável, atóxica, esterilizada, em PVC flexível, transparente, atraumática, com orifícios laterais, tipo Levine, longa Nº: 10. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Embalagem com 10 unidades. Total 120 unidades/sondas. Pedir amostra.
    120Unidade
    Produto/Serviço: Sonda uretral nº 10
    Descrição: Sonda uretral, material PVC atóxico siliconizado, tamanho nº 10, características adicionais maleável,transparente,atraumática, tipo uso descartável, esterilidade estéril, tipo embalagem embalagem individual. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Embalagem com 10 unidades. Total 200 unidades/sondas. Pedir amostra.
    200Unidade
    Produto/Serviço: Sonda uretral nº 18
    Descrição: Sonda uretral, material PVC atóxico siliconizado, tamanho nº 18, características adicionais maleável,transparente,atraumática, tipo uso descartável, esterilidade estéril, tipo embalagem embalagem individual. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Embalagem com 10 unidades. Total 20 unidades/sondas. Pedir amostra.
    20Unidade
    Produto/Serviço: Sonda uretral nº 04
    Descrição: Sonda uretral, material PVC atóxico siliconizado, tamanho nº 04, características adicionais maleável,transparente,atraumática, tipo uso descartável, esterilidade estéril, tipo embalagem embalagem individual. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Embalagem com 10 unidades. Total 100 unidades/sondas. Pedir amostra.
    100Unidade
    Produto/Serviço: Sonda uretral nº 06
    Descrição: Sonda uretral, material PVC atóxico siliconizado, tamanho nº 06, características adicionais maleável,transparente,atraumática, tipo uso descartável, esterilidade estéril, tipo embalagem embalagem individual. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Embalagem com 10 unidades. Total 100 unidades/sondas. Pedir amostra.
    100Unidade
    Produto/Serviço: Sonda uretral nº 08
    Descrição: Sonda uretral, material PVC atóxico siliconizado, tamanho nº 08, características adicionais maleável,transparente,atraumática, tipo uso descartável, esterilidade estéril, tipo embalagem embalagem individual. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Embalagem com 10 unidades. Total 300 unidades/sondas. Pedir amostra.
    300Unidade


    28457/2014
    05/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Agulha hipodérmica 25 x 7
    Descrição: Agulha hipodérmica descartável para punção, cânula em aço inoxidável, canhão de material plástico atóxico ou liga de alumínio em cores de acordo com o padrão de codificação do calibre (NBR), bisel trifacetado, siliconizado em superfície externa, atraumática, estéril, apirogênico e atóxico com tampa plástica protetora, Nº 25 x 7. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Total 5.000 unidades/agulhas. Pedir amostra.
    5000Unidade
    Produto/Serviço: Agulha hipodérmica 25 x 8
    Descrição: Agulha hipodérmica descartável para punção, cânula em aço inoxidável, canhão de material plástico atóxico ou liga de alumínio em cores de acordo com o padrão de codificação do calibre (NBR), bisel trifacetado, siliconizado em superfície externa, atraumática, estéril, apirogênico e atóxico com tampa plástica protetora, Nº 25 x 8. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Total 1.800 unidades/agulhas. Pedir amostra.
    1800Unidade
    Produto/Serviço: Agulha hipodérmica 30 x 8
    Descrição: Agulha hipodérmica descartável para punção, cânula em aço inoxidável, canhão de material plástico atóxico ou liga de alumínio em cores de acordo com o padrão de codificação do calibre (NBR), bisel trifacetado, siliconizado em superfície externa, atraumática, estéril, apirogênico e atóxico com tampa plástica protetora, Nº 30 x 8. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Total 200 unidades/agulhas. Pedir amostra.
    200Unidade
    Produto/Serviço: Agulha hipodérmica 40 x 10
    Descrição: Agulha hipodérmica descartável para punção, cânula em aço inoxidável, canhão de material plástico atóxico ou liga de alumínio em cores de acordo com o padrão de codificação do calibre (NBR), bisel trifacetado, siliconizado em superfície externa, atraumática, estéril, apirogênico e atóxico com tampa plástica protetora, Nº 40x10. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Total 200 unidades/agulhas. Pedir amostra.
    200Unidade
    Produto/Serviço: Agulha hipodérmica 40 x 12
    Descrição: Agulha hipodérmica descartável para punção, cânula em aço inoxidável, canhão de material plástico atóxico ou liga de alumínio em cores de acordo com o padrão de codificação do calibre (NBR), bisel trifacetado, siliconizado em superfície externa, atraumática, estéril, apirogênico e atóxico com tampa plástica protetora, Nº 40x12. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Total 2.000 unidades/agulhas. Pedir amostra.
    2000Unidade
    Produto/Serviço: Agulha hipodérmica 40 x 16
    Descrição: Agulha hipodérmica descartável para punção, cânula em aço inoxidável, canhão de material plástico atóxico ou liga de alumínio em cores de acordo com o padrão de codificação do calibre (NBR), bisel trifacetado, siliconizado em superfície externa, atraumática, estéril, apirogênico e atóxico com tampa plástica protetora, Nº 40x16. Embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na ANVISA/MS. Validade de no mínimo 1 ano. Total 1.500 unidades/agulhas. Pedir amostra.
    1500Unidade


    28459/2014
    04/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Alcool Etílico 70% - almotolia com 250ml
    Descrição: Alcool Etílico 70% - almotolia com 250mL. Validade de no mínimo 1 ano. Total de 1.500 almotolias/frascos.
    1500Unidade
    Produto/Serviço: Alcool Etílico 70% - frasco com 1000ml (1litro)
    Descrição: Alcool Etílico 70% - frasco com 1000ml (1litro). Validade de no mínimo 1 ano. Total de 240 frascos/unidades de 1 litro.
    240Unidade
    Produto/Serviço: PVPI Topico -almotolia com 100ml
    Descrição: Solução aquosa tópica a base de Iodopovidona 10 % com 1 % de iodo livre. Validade de no mínimo 1 ano. Total de 300 almotolias/unidades com 100mL.
    300Unidade
    Produto/Serviço: PVPI Degermante - almotolia com 100ml
    Descrição: Solução degermante a base de polivinil pirrolidona iodo (PVP-I) contendo 1% de iodo ativo. Validade de no mínimo 1 ano. Total de 1.000 unidades/almotolias
    1000Unidade
    Produto/Serviço: PVPI Tintura - almotolia com 100ml
    Descrição: PVPI Tintura é um produto a base de polivinil pirrolidona iodo (PVP-I) em solução hidroalcoólica, contendo 1% de iodo ativo. Validade de no mínimo 1 ano. Total de 300 unidades/almotolias com 100mL.
    300Unidade


    28460/2014
    04/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Escova degermante com gliconato de clorexidina a 2%
    Descrição: Escova degermante com gliconato de clorexidina: dupla face para degermação da pele, descartável, com corpo em material plástico, atóxico, apirogênico, flexível, livre de defeitos, tendo em uma das faces, cerdas macias que não causem abrasão e na outra esponja macia de poliuretano, impregnada com 2 ml de solução de gliconato de c lorexidina a 2%. Embalagem individual com selagem eficiente que garanta a integridade do produto até o momento de sua utilzação, permita a abertura e a transferência com técnica aséptica, trazendo externamente os dados de identifcação, procedência, número de lote, data de fabricação, prazo validade mínimo deve ser de 12 meses a partir da data de entrega. Total de 1920 unidades/escovas. Pedir amostra.
    1920Unidade
    Produto/Serviço: Escova Degermante com Iodopovidona (PVPI)
    Descrição: Escova degermante com iodopovidona: dupla face para degermação de pele, descartável, com corpo em material plástico, atóxico, apirogênico, flexível, livre de defeitos, tendo em uma das faces, cerdas macias que não causem abrasão e na outra, esponja macia de poliuretano, impregnada com 10 ml de solução de iodopovidona a 10%. Embalagem individual com selagem eficiente que garanta a integridade do produto até o momento de sua utilzação, permita a abertura e a transferência com técnica aséptica, trazendo externamente os dados de identifcação, procedência, número de lote, data de fabricação, prazo de validade e número de registro no Ministério da Saúde. O prazo de validade mínimo deve ser de 12 meses a partir da data de entrega. Total de 960 unidades/escovas. Pedir amostra.
    960Unidade


    28512/2014
    03/11/2014 16:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física CLT para o cargo de Auxiliar de projetos. Salário - R$ 1.600,00 + Vale alimentação + vale transporte. Algumas atribuições: Atuar diretamente na área administrativa realizando as tarefas abaixo relacionadas: - Recebimento e arquivo de documentos - Assessoramento geral ao coordenador nas rotinas diárias e diferenciadas - Preparação, acompanhamento, agendamento, o estoque e a distribuição de material e serviços - Controlar o registro de patrimônio - Controle de pagamentos de material e serviços
    1Unidade


    28658/2014
    05/10/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Trizol Reagent 200 ml Ambion/RNA
    Descrição: trizol Reagent 200 ml Ambion/RNA REF: 15596018
    1Caixa


    28702/2014
    05/10/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Myristic acid M3128 100g
    Descrição: Myristic acid M3128
    1Unidade
    Produto/Serviço: Palmitic acid P0625 25g
    Descrição: Palmitic acid P0625
    1Unidade
    Produto/Serviço: Oleic acid 75096 1 litro
    Descrição: Oleic acid 75096
    1Litro
    Produto/Serviço: Cholesterol C 8503 25g
    Descrição: Cholesterol
    1Unidade
    Produto/Serviço: Squalene S 3626 100 ml
    Descrição: Squalene S
    1Unidade
    Produto/Serviço: Oil Red O 00625 25g
    Descrição: Oil Red
    1Unidade


    28782/2014
    06/10/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Passagem
    Descrição: Passagem aérea para: Radagasio Hugo Vervloet Filho IDA: 06/10/2014 Vitória/ES X Rio de Janeiro/RJ VOLTA: 10/10/2014 Rio de Janeiro/RJ X Vitória/ES
    1Unidade


    28784/2014
    06/10/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Passagem
    Descrição: Passagem - Radagasio Hugo Vervloet Filho - IDA - Vitória/ES X Rio de Janeiro/RJ 10/11/2014 (horário mais sedo possível) - VOLTA - Rio de Janeiro/RJ X Vitória/ES 14/11/2014 (horário mais tarde possível)
    1Unidade


    28825/2014
    06/10/2014 16:00:00
    Dispensa de licitação Material de Escritório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Banner
    Descrição: Material de Consumo banner em papel sulfite tamanho 1.20 X 0.90 sem abacamento.
    45Unidade


    28845/2014
    06/10/2014 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: nitrogênio líquido
    Descrição: Nitrogênio liquido - 250 litros
    250Litro


    28853/2014
    06/10/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea nacional
    Descrição: Passagem aérea nacional para: Marcelo Costa IDA: 19/10 Natal/Florianópolis TAM 12:10 chegando 19:33 IDA: 21/10 Florianópolis/Guarulhos TAM 13:47 chegando 15:05 VOLTA: 24/10 Guarulhos/Natal TAM 21:50 chegando 00:13
    1Unidade


    28854/2014
    06/10/2014 16:00:00
    Dispensa de licitação Passagens Aéreas
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: passagem aérea internacional
    Descrição: Compra de passagem aérea internacional ida e volta, voo direto, sem escalas, conforme sugestão em anexo. NOME DO BENEFICIÁRIO: João António Catita Garcia Pereira; PASSAPORTE: M 397057 (Portugal); TELEFONE: + 351 962 771 809; EMAIL: jpereira@ensp.unl.pt; TRECHO DA VIAGEM: Portugal / Belo Horizonte / Portugal VOO DE IDA 09/11/2014: Portugal - LIS -> Belo Horizonte - CNF --> Horário Após 13horas. VOO DE VOLTA 12/11/2014: Belo Horizonte - CNF -> Portugal - LIS --> Horário Após 20horas.
    1Unidade