ÁREA DO FORNECEDOR

ACESSO RESTRITO








Conheça aqui os critérios utilizados na concepção e operacionalização deste Portal.

Clique aqui e saiba como fazer seu cadastro no Portal do Fornecedor.

Conheça aqui a Política do Fornecedor.


Destaques


A FEPMVZ recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
    2065/2014
    31/12/2014 00:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física para Tutor de ensino a distancia
    3Unidade


    2726/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física Edital 002/2014 - Secretaria
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Analista de Sistemas Junior
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Enfermeiro
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Analista de Sistemas Pleno
    1Unidade


    2727/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 003/2014 Processo seletivo simplificado - Auxiliar de Projeto
    1Unidade


    2734/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Processo seletivo Edital 004/2014 - Analista I
    1Unidade


    3382/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Processo Seletivo Contratação de Pessoa Física Secretaria Executiva Edital: 006/2014
    1Unidade


    4963/2014
    31/12/2014 16:00:00
    Concorrência Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: serviço
    Descrição: Contratação de empresa de engenharia e Mão de obra, e fornecimento de materiais, e equipamentos para a reforma do Laboratorio Oficial de Analise de sementes Superior.
    1Unidade


    5046/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Auxiliar adminstrativo
    Descrição: Fundação de Estudo e Pesquisa em Medicina Veterinária e Zootecnia - FEPMVZ SOLICITAÇÃO DE REALIZAÇÃO DE PROCESSO SELETIVO Centro de Custo: Projeto: Projeto de manutenção e ampliação do Centro Regional de Referência para formação permanente de profissionais ligados a assistência de familiares e usuários de Crack da Universidade Federal de Minas Gerais no município de Belo Horizonte Coordenador: Frederico Duarte Garcia Contratação: (X) CLT ( ) Prestação de serviço PRE-REQUISITOS PARA A CONTRATAÇAO Função/Serviço: Auxiliar administrativo Salário/Valor: R$2.5000,00 (valor bruto com os encargos patronais) Período: Fevereiro / 2014 a julho de 2015 Forma de Pagamento: mensal/depósito em conta corrente Jornada de Trabalho (CLT): 6 horas diárias e 5 dias por semana Subordinação (CLT): Escolaridade: Nível superior dentro da área de administração, ou saúde, ou reabilitação. Fluente em língua inglesa Experiência: Experiência, em gestão geral e organização de eventos Atribuições: 1. Controle de agenda e compromissos 2. Planejamento de viagens 3. Despacho e conferência de documentos 4. Organização de arquivos 5. Atendimento telefônico 6. Recepção de colaboradores do CRR 7. Planejamento dos cursos e eventos do CRR 8. Atendimento a colaboradores do CRR 9. Organizar planning, redigir atas e súmulas de reuniões. 10. Conferência de documentos 11. Auxiliar no desenvolvimento e organização do CRR 12. Organização dos simpósios do CRR 13. Digitação e diagramação Exigências para desempenho das funções: Vagas: 1 (uma) Outros: Informação Complementar: CRITÉRIO PARA PONTUAÇAO Favor citar a pontuação que deve ser atribuída aos seguintes requisitos: 1 – Experiência Profissional: Serão atribuídos 70 (setenta) pontos na avaliação da experiência profissional e currículo, a qual será avaliada segundo os seguintes quesitos • Histórico de Conclusão do Curso de Graduação • Certificados/Declaração de Conhecimento em Informática • Certificado/Declaração de Curso de Línguas Estrangeiras. Experiência profissional relevante 2 – Prova de Entrevista: Serão atribuídos à entrevista 30 (trinta) pontos. Desta forma, solicito a contratação de pessoa física que atenda os requisitos informados acima. Belo Horizonte, 17/01/2013____ Professor: Frederico Garcia Assinatura:
    1Unidade


    5449/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Abertura de Processo Seletivo Simplificado - Edital 07/2014 Vaga - Assistente de processos R$ 1.600,00
    1Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Abertura de Processo Seletivo Simplificado - Edital 07/2014 - Vaga Assistente Administrativo R$ 1.350,00
    1Unidade


    5938/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física- Edital 009/2014 Abertura de processo seletivo simplificado 01vaga para: Tecnico em Pesquisa R$ 1.200,00 01 vaga para: Epidemiologista R$ 1.500,00
    2Unidade


    5940/2014
    31/12/2014 00:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 005/2014 Abertura de processo seletivo simplificado 01 vaga para: Tecnico de Farmacia R$ 900,00 01 vaga para: Tecnico em Enfermagem R$ 812,36
    2Unidade


    7585/2014
    25/04/2014 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Informática
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Impressora multifuncional de alta performance
    Descrição: Impressora Multifuncional laser preto e branco Qualidade de impressão de até 1200x1200 dpi Ciclo de trabalho mensal de até 50.000 cópias Memoria padrão de 256 MB Tamanhos de midia suportados: A4; A5; A6; B5 (JIS) Velocidade do Processador 800 MHz Velocidade de impressão de 35 ppm duplexadorautomá¡tico para impressão em frente e verso Conectividade padrão: 1 USB 2.0 de alta velocidadeEthernet 10/100/1000T, 1 USB direto, 1 USB 2.0 de alta velocidade, 1 host USB, 1 RJ-11 (fax) Modelo de referência Multifuncional Samsung SL M4070FR ProXpress; Lexmark MX410DE;
    1Unidade
    Produto/Serviço: Impressora colorida
    Descrição: Qualidade de impressão Cor: Até 1200 x 1200 dpi e Preto: Até 1200 x 1200 dpi Ciclo de trabalho mensal de até 30.000 cópias Memoria padrão de 512 MB Tamanhos de midia suportados: A4; A5; A6; B5 (JIS) Velocidade do Processador 480 MHz Velocidade de impressão preto de 20 ppm e colorido de 15 ppm Conectividade padrão: 1 USB 2.0 de alta velocidadeEthernet 10/100 base –TX , 1 USB direto, 1 USB 2.0 de alta velocidade, 1 host USB, 1 RJ-11 (fax), 1 slot para cartão SD Modelo de referência Multifuncional HP Officejet Pro 276dw; LEXMARK LASER COLOR CX310DN; HP LASERJET COLOR PRO 200 M276NW; Samsung CLX 3350W
    1Unidade
    Produto/Serviço: Monitor 21''
    Descrição: Monitor 21,5 polegadas resolução 1920X1080 full HD com iluminação auxiliar por LED Tamanho dos pontos Máximo 0,24825 mm (H) x 0,24825 mm (V) Entradas VGA, DVI Certificações: Energy Star, TCO Modelos de referência: Samsung S22C300B; Dell E2014H; HP E221c; Benq GW2255; Philips 223V5lSB2;
    2Unidade
    Produto/Serviço: Projetor multimídia
    Descrição: Luminosidade: 3000 lumens (ANSI máximo) Taxa de contraste: 2.200:1 Resolução nativa: XGA (1024X768) Taxa de proporção: 4:3 Lentes: F/2,8; distância focal eficaz f=7,26; Lente fixa Distância de projeção: 0,4 metros a 3,82 metros Tamanho da tela diagonal 0,8 metros a 7,5 metros Cores para exibição: até 1,07 bilhão Lâmpada com vida útil de no mínimo 3.000 horas Ruído máximo de 35 dB(A) Entradas: VGA, s-vídeo, vídeo composto, HDMI, áudio analógico, RS232. Auto-falante integrado e controle remoto Modelo de referência: Dell S320
    1Unidade
    Produto/Serviço: Refrigerador compacto
    Descrição: Refrigerador compacto 120 litros, com dimensões de 48X52X86 cm, com grade retrátil, gaveta multiuso com tampa aproveitável, porta-latas e prateleiras modulares. Consumo de energia até25kWh/mês. Cor Branca
    1Unidade
    Produto/Serviço: Computador All in One
    Descrição: Sistema operacional: Windows 8 pro em português Processador da Intel® Core™ i7 (com no mínimo 3.2GHz até 3.9GHz, 8 Threads, 8Mb Cache) Memoria PC3-12800 DDR3 1600 SDRAM de 8GB 2x 4GB (com capacidade de expansão para 16GB) Unidade de disco rígido Serial ATA de 7.200 RPM e mínimo 1TB Teclado e mouse óptico sem fio Gravador de DVD SlimSuperMulti com carregamento por bandeja Rede: 10/100/1000 Wireless LAN 802.11b/g/n Monitor LED WidescreenFull HD de 23pol, com resolução de 1920 x 1080Multitouch’ FHD Moltitouch Placa de video integrada de 2GB de memoria dedicada Web CamfullHd 720 Microfone embutido Leitor de cartão SD Modelo de referência : Dell InspironOne 2330
    1Unidade
    Produto/Serviço: Computador All in one
    Descrição: Sistema operacional: Windows 8 pro em português Processador da Intel® Core™ i5 (com no mínimo 3.30 GHz, Cache de 3 MB) Memoria PC3-12800 DDR3 1600 SDRAM de 4GB 2x 2GB (com capacidade de expansão para 16GB) Unidade de disco rígido Serial ATA de 7.200 RPM e mínimo 500GB Teclado e mouse óptico sem fio Gravador de DVD SlimSuperMulti com carregamento por bandeja Rede: 10/100/1000 Wireless LAN 802.11b/g/n Monitor LED Monitor widescreen HD de mínimo de 20 na diagonal resolução 1600 x 900 com iluminação auxiliar por LED Placa de vídeo integrada de 2GB de memoria dedicada Web CamfullHd 720 Microfone embutido Leitor de cartão SD Modelos de referência: Dell 3011-A20; LG V320; HP Compaq Elite 8300 All-in-One B8U98LT; HP ENVY Recline; Dell All in One F530
    2Unidade
    Produto/Serviço: Computador Notebook
    Descrição: Sistema operacional: Windows 8 Computador notebook com processador Intel® Core™ i3 Disco rígido de 1 terabite SATA 7200 rpm; Porta de rede e conector sem fio, 4Gigabites de memória RAM de tipo DDR3L; 2 portas USB (3.0) e duas portas (2.0); Placa de vídeo integrada e memória dedicada; web cam, Portas de leitura de cartão tipoMemory Stick PRO, SD, xD, MMC,Memory Stick, SDXC, ; Tela LED backlit de 14 polegadas e resolução HD 1366X768; Alto falantes integrados; Web CamfullHd 720 Blutooth 4.0; teclado alfanumérico português, mouse touchpad; Gravador de DVD/CD; bateria com até 6h30 de autonomia; conversor AC; Modelos de referência: HP 1000-1440BR; Aspire E1-471-6627
    1Unidade


    7844/2014
    31/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Processo Seletivo
    Descrição: Edital 011/2014- Abertura de processo seletivo simplificado para contratação de empregados - 02 vagas para auxiliar administrativo R$ 900,00
    2Unidade


    9759/2014
    30/12/2014 16:00:00
    Processo Seletivo Simplificado Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física- Processo Seletivo 013/2014 Função: Tutor de Ensino a distância.
    1Unidade


    10008/2014
    18/04/2014 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Cabra anti-Porco, IgA, cadeia específica alfaHRP
    Descrição: Cabra anti-Porco, IgA, cadeia específica alfaHRP, (Goat anti-Pig, IgA, alpha chain specificHRP) (Peroxidase conjugada), frasco com 1ml Marca : Bethyl Referência : A100-102P
    1Frasco


    10698/2014
    18/04/2014 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Enzima de restrição DdeI
    Descrição: Enzima de restrição ER1881 HpyF3I (DdeI) 500 units,R$ 267,75, SINAPSE
    500Frasco


    10751/2014
    17/04/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Ion PGM™ Hi-Q™ Sequencing Kit, Empresa Life Technologies cat n° A24571
    Descrição: Ion PGM™ Hi-Q™ Sequencing Kit, Empresa Life Technologies cat n° A24571
    1Kit


    10872/2014
    18/04/2014 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Teste
    Descrição: O teste rápido imunocromatográfico para detecção rápida do anticorpo IgM para o vírus da dengue no soro, plasma ou sangue total de seres humanos. O teste deve apresentar resultados (sensibilidade, especificidade, acurácia) descritos na literatura técnica correspondente. O Kit deve fornecer todo material para completa execução do teste. Deve ter registro na ANVISA
    200Unidade


    10873/2014
    18/04/2014 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Teste
    Descrição: O teste rápido imunocromatográfico para detecção rápida do antígeno NS1 para o vírus da dengue no soro, plasma ou sangue total de seres humanos. O teste deve apresentar resultados (sensibilidade, especificidade, acurácia) descritos na literatura técnica correspondente. O Kit deve fornecer todo material para completa execução do teste. Deve ter registro na ANVISA.
    200Caixa


    11209/2014
    30/04/2014 00:00:00
    Dispensa de licitação Material de Escritório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: carimbo
    Descrição: carimbo para o coordenador do Cenex com as seguintes descrições: PROF. MATHEUS ANCHIETA RAMIREZ COORDENADOR DO CENEX EV/UFMG
    1Unidade


    11417/2014
    17/04/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: termometro digital
    Descrição: TERMÔMETRO DIGITAL DE MÁXIMO E MÍNIMO, COM CERTIFICADO DE CALIBRAÇÃO RBC NAS FAIXAS DE 20º A 25ºC E DE 25º A 30º. ***ATENÇÃO É NECESSÁRIO O CERTIFICADO DE CALIBRAÇÃO NAS FAIXAS ESPECIFICADAS.****
    1Unidade
    Produto/Serviço: termômetro
    Descrição: Termômetro de vidro, com certificado de calibração RBC nas faixas de 20º a 25ºC e de 25º a 30º. ***ATENÇÃO É NECESSÁRIO O CERTIFICADO DE CALIBRAÇÃO NAS FAIXAS ESPECIFICADAS***
    1Unidade


    11584/2014
    20/04/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Éter Gliceril Guaiacol - (EGG)
    Descrição: Éter Gliceril Guaiacol - (EGG)
    5Frasco


    11586/2014
    20/04/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: WS Proteínas Totais - KOVALENT
    Descrição: WS Proteínas Totais - KOVALENT
    2Kit
    Produto/Serviço: WS Fosfatase Alcalina - KOVALENT
    Descrição: WS Fosfatase Alcalina - KOVALENT
    2Kit
    Produto/Serviço: WS Gama GT - KOVALENT
    Descrição: WS Gama GT - KOVALENT
    2Kit
    Produto/Serviço: WS Topkon N Controle normal - KOVALENT
    Descrição: WS Topkon N Controle normal - KOVALENT
    2Kit
    Produto/Serviço: D - Check D Diagon
    Descrição: D - Check D Diagon
    1Kit
    Produto/Serviço: Tubo Capilar (Microhematócrito) sem Heparina
    Descrição: Tubo Capilar (Microhematócrito) sem Heparina
    10Unidade
    Produto/Serviço: Urinálise tiras reagentes de teste
    Descrição: Urinálise tiras reagentes de teste
    5Kit
    Produto/Serviço: Lamínula para MICROSCÓPIO 18 X 18, Caixa com 100 unidades
    Descrição: Lamínula para MICROSCÓPIO 18 X 18, Caixa com 100 unidades
    5Caixa
    Produto/Serviço: Lâmina Microscopia 26 x 76 mm Ponta fosca lapidada caixa com 50 unidades
    Descrição: Lâmina Microscopia 26 x 76 mm Ponta fosca lapidada caixa com 50 unidades
    1Peça
    Produto/Serviço: WS Amilase (Alfa Amilase G7) - KOVALENT
    Descrição: WS Amilase (Alfa Amilase G7) - KOVALENT
    2Kit


    11588/2014
    20/04/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Fio Categute Cromado 2 - caixa com 24 envelopes
    Descrição: Fio para sutura, caixa com 24 envelopes.
    3Unidade
    Produto/Serviço: Fio Carprofyl 0 - caixa com 24 envelopes
    Descrição: Fio para sutura, caixa com 24 envelopes.
    9Caixa
    Produto/Serviço: Fio Carprofyl 1 - caixa com 24 envelopes
    Descrição: Fio de sutura tamanho 70cm e comagulha de 31mm, caixa com 24 envelopes
    1Caixa
    Produto/Serviço: Fio Carprofyl 4 - caixa com 24 envelopes
    Descrição: Fio para sutura tamanho 70cm com agulha 31 mm, caixa com 24 envelopes
    1Caixa
    Produto/Serviço: Fio Carprofyl 2-0 - caixa com 24 envelopes
    Descrição: Fio para sutura de 70cm com agulha de 31mm, caixa com 24 envelopes
    20Caixa
    Produto/Serviço: Fio Carprofyl 3-0 - caixa com 24 envelopes
    Descrição: Fio para sutura com 70 cm e agulha de 31 mm, caixa com 24 envelopes
    10Caixa
    Produto/Serviço: Fio Nylon 0 - caixa com 24 envelopes
    Descrição: Fio para sutura com agulha, caixa com 24 envelopes
    10Caixa
    Produto/Serviço: Fio Nylon 2-0 - caixa com 24 envelopes
    Descrição: Fio para sutura com agulha, caixa com 24 envelopes
    15Caixa
    Produto/Serviço: Fio Nylon 3-0 - caixa com 24 envelopes
    Descrição: Fio para sutura com agulha, caixa com 24 envelopes.
    30Unidade


    11593/2014
    20/04/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Oligonucleotídeo FNO12_402_F
    Descrição: Oligonucleotídeo FNO12_402_F Escala: 25 nmol Sequencia 5' 3' CTGAGAAGCAGCTGTTGACG
    1Pacote
    Produto/Serviço: Oligonucleotídeo FNO12_402_R
    Descrição: Oligonucleotídeo FNO12_402_R Escala: 25 nmol Sequencia 5' 3' CCCAAATGTTATTGGTGAAGA
    1Pacote
    Produto/Serviço: Oligonucleotídeo FNO12_661_F
    Descrição: Oligonucleotídeo FNO12_661_F Escala: 25 nmol Sequência: 5' 3' CCAGAACGAAAAGAGCTTGG
    1Pacote
    Produto/Serviço: Oligonucleotídeo FNO12_661_R
    Descrição: Oligonucleotídeo FNO12_661_R Escala: 25 nmol Sequência: 5' 3' GTATGTTAGCGGCGTCAGC
    1Pacote
    Produto/Serviço: Oligonucleotídeo FNO12_417_F
    Descrição: Oligonucleotídeo FNO12_417_F Escala: 25 nmol Sequência: 5' 3' CCTCGGCTAATTTGCACTTC
    1Pacote
    Produto/Serviço: Oligonucleótideo FNO12_417_R
    Descrição: Oligonucleótideo FNO12_417_R Escala: 25 nmol Sequência: 5' -3' GCATCAGGATACGCAAAGGT
    1Pacote
    Produto/Serviço: Oligonucleotídeo FNO12_616_F
    Descrição: Oligonucleotídeo FNO12_616_F Escala: 25 nmol Sequência: 5'-3' CTGCGGAGATGAGAAAGTTG
    1Pacote
    Produto/Serviço: Oligonucleotídeo FNO12_616_R
    Descrição: Oligonucleotídeo FNO12_616_R Escala: 25 nmol Sequência: 5'-3' GACCTTGAGCAGCAGAAGC
    1Pacote


    11625/2014
    20/04/2014 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: termometro digital incoterm
    Descrição: termômetro digital- marca Incoterminas TERMÔMETRO DIGITAL INT -10C+50:0,1C EXT -50C~+70:0,1C MAX MIN COM ALARME CABO 1M80 - codigo: 7427.02.0.00
    16Unidade