ÁREA DO FORNECEDOR

ACESSO RESTRITO








Conheça aqui os critérios utilizados na concepção e operacionalização deste Portal.

Clique aqui e saiba como fazer seu cadastro no Portal do Fornecedor.

Conheça aqui a Política do Fornecedor.


Destaques


A FEPE recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
    13599/2015
    21/04/2016 16:00:00
    Pregão eletrônico
    40/2015 Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Material de Consumo
    Descrição: Material Hospitalar - Licitação 002/2015
    1Unidade


    15028/2015
    30/09/2015 16:00:00
    Processo Seletivo Simplificado
    8/2015 Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Edital: 008/2015 Abertura de processo seletivo simplificado. Vaga: Auxiliar de projetos Salario: R$ 1.600,00- CLT ( 44 horas)
    1Unidade


    16798/2015
    30/09/2015 16:00:00
    Processo Seletivo Simplificado
    9/2015 Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Edital 010/2015 - Periodo de inscriçoes: 25/05/2015 a 29/05/2015 - Horario: das 09:00 as 11:00 - Auxiliar de Farmacia: Salario: R$ 942,14 Ticket R$ 440,00 e vale transporte
    1Unidade


    24391/2015
    31/08/2015 17:00:00
    Dispensa de licitação
    762/2015 Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: BALAO VOLUMETRICO VIDRO CLASSE A ROLHA POLIETILENO 1 ML COM CERTIFICADO DE CALIBRAÇÃO RASTREÁVEL RBC
    Descrição: BALAO VOLUMETRICO VIDRO CLASSE A ROLHA POLIETILENO 1 ML COM CERTIFICADO DE CALIBRAÇÃO RASTREÁVEL RBC Marcas: Pyrex Duran
    10Unidade
    Produto/Serviço: BALAO VOLUMETRICO VIDRO CLASSE A ROLHA POLIETILENO 2 ML COM CERTIFICADO DE CALIBRAÇÃO RASTREÁVEL RBC
    Descrição: BALAO VOLUMETRICO VIDRO CLASSE A ROLHA POLIETILENO 2 ML COM CERTIFICADO DE CALIBRAÇÃO RASTREÁVEL RBC Marcas: Pyrex Duran
    10Unidade
    Produto/Serviço: CADINHO DE FUSÃO EM PORCELANA FORMA ALTA (10 a 30 mL)
    Descrição: CADINHO DE FUSÃO EM PORCELANA FORMA ALTA (10 a 30 mL) Marcas: Chiarotti EasyPath
    5Unidade
    Produto/Serviço: CARTUCHOS PARA EXTRAÇÃO EM FASE SÓLIDA STRATA X
    Descrição: CARTUCHOS PARA EXTRAÇÃO EM FASE SÓLIDA STRATA X Pacotes com 100 unidades. Marcas: Phenomenex
    2Pacote
    Produto/Serviço: COLUNA CROMATOGRÁFICA CHIROBIOTIC V (150 X 2,1 mm; 5 µm)
    Descrição: COLUNA CROMATOGRÁFICA CHIROBIOTIC V (150 X 2,1 mm; 5 µm) Marca: SUPELCO
    1Unidade
    Produto/Serviço: COLUNA CROMATOGRÁFICA CIANO (150 x 4,6 m; 5 µm)
    Descrição: COLUNA CROMATOGRÁFICA CIANO (150 x 4,6 m; 5 µm) Marca: ACE Nova-pak (Waters) Fornecedores: LAS do Brasil, LabScience, Alcrom, Biosan
    1Unidade
    Produto/Serviço: COLUNA CROMATOGRÁFICA DE OCTADECILSILANO (100 x 4,6 m; 5 µm)
    Descrição: COLUNA CROMATOGRÁFICA DE OCTADECILSILANO (100 x 4,6 m; 5 µm) Marca: ACE
    1Unidade
    Produto/Serviço: COLUNA CROMATOGRÁFICA WATERS ACQUITY BEH C18 (50 X 2,1 mm; 1,7 µm)
    Descrição: COLUNA CROMATOGRÁFICA WATERS ACQUITY BEH C18 (50 X 2,1 mm; 1,7 µm) Marca: Ace
    1Unidade


    24808/2015
    02/09/2015 00:00:00
    Dispensa de licitação
    776/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Vials - 12 × 32 mm Screw Top vials, pre-slit
    Descrição: Vials - 12 × 32 mm Screw Top vials, pre-slit Caixa com 100 unidades
    1Caixa
    Produto/Serviço: Acetonitrila grau MS
    Descrição: Acetonitrila grau MS
    4Litro
    Produto/Serviço: Metanol grau MS
    Descrição: Metanol grau MS
    4Litro


    25231/2015
    04/09/2015 16:00:00
    Dispensa de licitação
    783/2015 Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Balde plastico
    Descrição: Balde plástico capacidade 5 litros
    3Unidade
    Produto/Serviço: Balde plastico
    Descrição: Balde plástico capacidade 10 litros
    2Unidade
    Produto/Serviço: tesoura
    Descrição: Tesoura
    1Unidade
    Produto/Serviço: Cabresto com fecho de argola
    Descrição: Cabresto com fecho de argola
    2Unidade


    25865/2015
    03/09/2015 00:00:00
    Dispensa de licitação
    808/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Oligonucletideo Saga Probe
    Descrição: Produto/Serviço: Oligonucletideo Saga Probe 1 Unidade Real Escala: 10 nmol Sequência: 5' FAM- AGCTCAAGTTAACGATGTAAAGGCA - NFQ 3' NFQ- non-fluorescente quencher: BHQ1 ou Iowa Black
    1Unidade


    26066/2015
    31/08/2015 00:00:00
    Dispensa de licitação
    820/2015 Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: DOXORRUBICINA, CLORIDRATO 10MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA
    Descrição: DOXORRUBICINA, CLORIDRATO 10MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA REGISTRO MS/ANVISA VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE DO PRODUTO
    15Frasco
    Produto/Serviço: EPIRRUBICINA, CLORIDRATO 10MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA C/ DILUENTE
    Descrição: EPIRRUBICINA, CLORIDRATO 10MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA C/ DILUENTE REGISTRO MS/ANVISA VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE DO PRODUTO
    5Frasco
    Produto/Serviço: GENCITABINA 200MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA
    Descrição: GENCITABINA 200MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA REGISTRO MS/ANVISA VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE DO PRODUTO
    10Frasco


    26091/2015
    04/09/2015 16:00:00
    Dispensa de licitação
    821/2015 Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Divisorias
    Descrição: Divisorias para fechamento de sala
    4Unidade
    Produto/Serviço: vidro
    Descrição: Vidro para janela 1mx1m
    1Unidade


    26258/2015
    01/09/2015 16:00:00
    Pregão eletrônico
    100/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: CLOREXIDINA, GLICONATO 0,5% - SOLUÇÃO HIDROALCOOLICA - FRASCO C/ 1 LITRO
    Descrição: CLOREXIDINA, GLICONATO 0,5% - SOLUÇÃO HIDROALCOOLICA - FRASCO C/ 1 LITRO. REGISTRO ANVISA/MS. NOME DO RESPONSÁVEL TÉCNICO. PRAZO DE VALIDADE DE NO MÍNIMO 75% DA ESPECIFICADA NO RÓTULO.
    12Frasco
    Produto/Serviço: CLOREXIDINA, GLICONATO 2% - SOLUÇÃO DEGERMANTE FRASCO C/ 1 LITRO
    Descrição: CLOREXIDINA, GLICONATO 2% - SOLUÇÃO DEGERMANTE FRASCO C/ 1 LITRO. REGISTRO ANVISA/MS. NOME DO RESPONSÁVEL TÉCNICO. PRAZO DE VALIDADE DE NO MÍNIMO 75% DA ESPECIFICADA NO RÓTULO.
    12Frasco
    Produto/Serviço: POVIDINE (PVPI) DEGERMANTE FRASCO C/ 1 LITRO
    Descrição: IODOPOLIVIDONA (PVPI) 10% (EQUIVALENTE A 1% DE IODO ATIVO), SOLUÇÃO DEGERMANTE, FRASCO C/ 1 LITRO. REGISTRO. VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    12Frasco


    26402/2015
    01/09/2015 16:00:00
    Pregão eletrônico
    103/2015 Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: grama
    Descrição: * Dois caminhões de grama e rolo * Plantio das gramas serão do dia 08 a 11/09/2015
    2Unidade
    Produto/Serviço: grama
    Descrição: * Dois caminhões de grama em placa * Plantio das gramas serão do dia 08 a 11/09/2015
    2Unidade


    26448/2015
    02/09/2015 16:00:00
    Dispensa de licitação
    832/2015 Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Manutenção de ar condicionado piso-teto com defeito sala de ultrafreezeres DMVP
    Descrição: Manutenção de ar condicionado piso-teto com defeito sala de ultrafreezeres DMVP
    1Unidade


    26606/2015
    31/08/2015 16:00:00
    Dispensa de licitação
    840/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: MAROPITANT,CITRATO 10MG/ML - 20ML (CERENIA)
    Descrição: MAROPITANT,CITRATO 10MG/ML - 20ML (CERENIA). REGISTRO NO MAPA. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA.
    20Unidade


    26608/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    841/2015 Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: PILHA ALCALINA TAMANHO 1,5V AA
    Descrição: PILHA ALCALINA TAMANHO 1,5V AA. MARCA SUGERIDA: DURACELL
    40Unidade
    Produto/Serviço: PILHA ALCALINA C - AM2 C LR14 ; 1.5 V
    Descrição: PILHA ALCALINA C - AM2 C LR14 ; 1.5 V. MARCA SUGERIDA: DURACELL
    10Unidade


    26610/2015
    31/08/2015 16:00:00
    Dispensa de licitação
    842/2015 Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Barbante 100% algodão - Rolo com 250 g
    Descrição: Barbante 100% algodão - Rolo com 250 g
    10Rolo


    26613/2015
    31/08/2015 16:00:00
    Dispensa de licitação
    844/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: INSULINA NPH HUMANA - 100 UI/ML FRASCO C/ 10 ML
    Descrição: INSULINA NPH HUMANA - 100 UI/ML FRASCO C/ 10 ML 75% DO PRAZO DE VALIDADE NA DATA DE ENTREGA.
    5Frasco
    Produto/Serviço: INSULINA REGULAR HUMANA 100UI/ML - FRASCO C/ 10ML
    Descrição: INSULINA REGULAR HUMANA 100UI/ML - FRASCO C/ 10ML 75% DO PRAZO DE VALIDADE NA DATA DE ENTREGA.
    2Frasco


    26614/2015
    31/08/2015 16:00:00
    Dispensa de licitação
    845/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: SUPLEMENTO ALIMENTAR HIPERCALÓRICO PARA DIETA ENTERAL DE CÃES E GATOS- MALTODEXTRINA, CASEINATO, PROTEÍNAS DO SORO DO LEITE, ÓLEO DE SOJA- 1KCAL/ML
    Descrição: SUPLEMENTO ALIMENTAR HIPERCALÓRICO PARA DIETA ENTERAL DE CÃES E GATOS COM MALTODEXTRINA, CASEINATO, PROTEÍNAS DO SORO DO LEITE, ÓLEO DE SOJA- 1KCAL/ML APÓS DILUIÇÃO. OSMOLARIDADE DE 445 mOsm/Kg ÁGUA, 29% DE LIPÍDEOS, 14% DE PROTEÍNAS, 57% DE CARBOIDRATOS, SEM LACTOSE, ENRIQUECIDO COM 13 VITAMINAS E 14 MINERAIS. PÓ PARA DILUIÇÃO EM ÁGUA EM EMBALAGEM INDIVIDUAL NA FORMA DE SACHÊ DE 21,8g. SUGESTÃO DE MARCA: SALUTE INOVET
    30Unidade


    26750/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    847/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: placa petri estéril descartável
    Descrição: placa petri estéril descartável
    1000Unidade


    26752/2015
    02/09/2015 16:00:00
    Dispensa de licitação
    849/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Tambor de imagens CE314A para impressora HP Laserjet 110 color MFP M175nw
    Descrição: Tambor de imagens CE314A para impressora HP Laserjet 110 color MFP M175nw
    1Unidade


    26753/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    850/2015 Material de Escritório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Etiqueta
    Descrição: Etiqueta A 5 R -909 MARCA BIC REDONDA PARA MICROTUBO - PIMACO, CAIXA COM 12 FOLHAS 9mm- A5 EVOLUTION
    5Caixa


    26755/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    852/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Phenol clorofórmio IAA 99%
    Descrição: Phenol clorofórmio IAA 99% -25:24:1 ph6,6
    1Frasco


    26756/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    853/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: microtubo tipo eppendorf 1,5ml clear com 500 unid
    Descrição:
    20Pacote
    Produto/Serviço: Ditiotreitol DTT
    Descrição:
    1Frasco


    26820/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    855/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: dNTPs
    Descrição: Solução de dNTP mix de nucleotídeos adenina, citosina, timina, guanina, utilizado para reações de PCR, na concentração de 10 mM cada nucleotídeo, com um volume final de 1000 ul/frasco.
    3Frasco
    Produto/Serviço: Nuclei Lysis Solution, número de catálogo A7943
    Descrição: Nuclei Lysis Solution, número de catálogo A7943, frasco de 1 litro, da Promega. O reagente faz parte de um kit de extração de DNA da Promega. Portanto, esse reagente específico tem que ser comprado para que o ki funcione propriamente.
    1Litro


    26821/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    856/2015 Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Hammerite cor preto (Tinta)
    Descrição: Tinta anti corrosiva - Hammerite cor preto (Tinta)
    3Lata
    Produto/Serviço: Thiner acabamento litro
    Descrição: Thiner acabamento litro
    2Lata
    Produto/Serviço: lixa Ferro 120
    Descrição: lixa Ferro 120
    4Unidade


    26920/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    858/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: LACTOBACILLI MRS AGAR -500g
    Descrição: LACTOBACILLI MRS AGAR da marca DIFCO ou FLUKA - 500G
    1Frasco
    Produto/Serviço: Caldo MRS Broth - 500G
    Descrição: Caldo MRS Broth - Marca Fluka - 500g
    1Frasco
    Produto/Serviço: ACETONA PA ACS 1000ML
    Descrição: ACETONA PA ACS 1000ML - ( PRODUTO CONTROLADO PELA PF)
    2Litro
    Produto/Serviço: Meio de montagem para lâminas histológicas e citológicas
    Descrição: Meio de montagem para lâminas histológicas e citológicas - ERV Mount - Marca easy path - 100ml
    5Frasco
    Produto/Serviço: Hematoxilina - 1LITRO
    Descrição: Hematoxilina - Coloração H&E ou coloração HE ou ainda coloração Hematoxilina-Eosina utilizados em Histologia e Citologia - 1LITRO
    3Unidade
    Produto/Serviço: Sacos para autoclave 60 litros
    Descrição: Sacos para autoclave 60 litros -Sacos plásticos descartáveis indicados para autoclavação de resíduos a 121ºC por 30 minutos- capacidade 60 litros- gramatura 0,08 micras): 100 unidades
    1Pacote


    26921/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    859/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: tubo capilar
    Descrição: Tubing, Capillary w/Frit, 25µ x 12in - Fabricante: Waters - Uso exclusivo no equipamento de Spectrometria de massas Synapt - nº catalogo 430002153
    1Unidade


    26933/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    861/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Gentamicina, sulfato 10,0 g/100,0 ML Medicamento veterinário
    Descrição: Gentamicina, sulfato 10,0 g/100,0 ML (PANGRAM 10%). MARCA SUGERIDA: VIRBAC REGISTRO MAPA. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA. Especificação: Pangram® 10% Cada 100 mL contém: Gentamicina (sulfato)....................10,0 g Veículo..............q.s.p............100,0 mL
    20Unidade


    26939/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    867/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Extensor 20 cm neonatal/pediátrico com controlador de fluxo tipo pinça (clamp) em pvc
    Descrição: Extensor 20 cm neonatal/pediátrico com controlador de fluxo tipo pinça (clamp) em pvc com conector luer fêmea e luer lock reversível transparentes, com pega não inferior a 1,5 cm. Estéril, apirogênico, atóxico, embalado individualmente em papel grau cirúrgico ou filme termoplástico contendo os dados impressos de identificação, lote, data de fabricação e validade e registro Anvisa/MS.
    600Unidade


    26942/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    868/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: COMPRESSA GAZE 7,5X7,5, 9 FIOS/cm2, 5 DOBRAS, 8 CAMADAS, NÃO ESTÉRIL, PACOTE COM 500 UNID
    Descrição: COMPRESSA GAZE 7,5 X 7,5, 9 FIOS/cm2, 5 DOBRAS, 8 CAMADAS, NÃO ESTÉRIL, PACOTE COM 500 UNIDADES
    120Pacote
    Produto/Serviço: COMPRESSA DE GAZE ROLO (TIPO QUEIJO)
    Descrição: COMPRESSA DE GAZE ROLO (TIPO QUEIJO)
    5Rolo


    26951/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    862/2015 Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Manutenção 2 pipetas automática multicanal
    Descrição: Revisão geral em duas micropipetas multicanal sendo calibração, ajuste e substituição de peças danificadas pelo uso normal.
    1Unidade


    26952/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    863/2015 Hospedagem
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Hospedagem
    Descrição: Hospedagem no HOTEL BOULEVARD PARK- RUA BERNARDO GUIMARÃES,925-FUNCIONÁRIOS-BHTE. TEL-32637000. PARA Aline Magalhães Nasser - ENTRADA EM 10/09/2015 SAÍDA EM 11/09/2015- QUARTO SIMPLES- SOMENTE HOSPEDAGEM, NÃO INCLUIR REFEIÇÃO.
    1Dia


    26957/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    865/2015 Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: copo descartável 200ml
    Descrição: Copo descartável com capacidade de 200ml
    3Caixa
    Produto/Serviço: copo descartável café 50ml
    Descrição: Copo descartável para café com capacidade de 50 ml
    3Caixa


    26982/2015
    01/09/2015 16:00:00
    Dispensa de licitação
    866/2015 Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Luvas
    Descrição: Luvas latex P com 100
    6Caixa
    Produto/Serviço: Luvas
    Descrição: Luvas Latex M - caixa com 100
    2Caixa
    Produto/Serviço: Hipoclorito
    Descrição: Hipoclorito de sódio 5% - 5.000ML
    6Galão