ÁREA DO FORNECEDOR

ACESSO RESTRITO








Conheça aqui os critérios utilizados na concepção e operacionalização deste Portal.

Clique aqui e saiba como fazer seu cadastro no Portal do Fornecedor.

Conheça aqui a Política do Fornecedor.


Destaques


A FEPMVZ recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
    26564/2014
    12/12/2015 00:00:00
    Pregão eletrônico Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: serviço
    Descrição: - PRESTAÇÃO DE SERVIÇO DE PERFURAÇÃO DE (02) DOIS POÇOS DE 80m e 90m, instalação, realização de teste de vazão, fornecimento e instalações de quadro de comando elétrico e conjunto moto-bomba submersa para poço tubular profundo a ser instalado, no terreno do Exercito Brasileiro do RJ na Vila Militar em Deodoro-RJ, utilização de Mão de Obra especializada e equipamentos, e deverá ter sede ou escritório no Rio de Janeiro, sendo; * Será obrigatória a visita ao local por parte dos licitantes interessados, antes da apresentação de suas propostas. Os licitantes interessados deverão fazê-lo para conhecer as condições, assim como, coletar informações, dados e elementos que possam vir a ter influência no desenvolvimento dos trabalhos, de modo que não serão atendidas solicitações durante os serviços, sob o argumento de falta de conhecimento das condições de trabalho ou de dados da especificação, sendo que a mesma será agendado para o dia 07de agosto de 2014 Agnaldo, Tel: 021- 97662-7796 . Após a visita técnica será emitido pelo responsável o Atestado de visita técnica que deverá integrar obrigatoriamente o site licitacoes-e.com.br.
    2Unidade


    6629/2015
    30/06/2015 00:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física Auxiliar Administrativo Salario: R$ 1.200,00 Jornada de trabalho 40 horas. Experiencia 02 anos.
    1Unidade


    10321/2015
    23/06/2015 16:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Auxiliar administrativo Salario: R$ 1.200,00 Periodo: 12 meses Jornada de trabalho: 40 Horas - CLT
    1Unidade


    10763/2015
    24/04/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: CLOREXIDINA, GLICONATO 2% - SOLUÇÃO DEGERMANTE FRASCO C/ 1 LITRO
    Descrição: CLOREXIDINA, GLICONATO 2% - SOLUÇÃO DEGERMANTE - FRASCO C/ 1 LITRO REGISTRO. VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    4Frasco
    Produto/Serviço: CLOREXIDINA, GLICONATO 0,5% - SOLUÇÃO HIDROALCOOLICA - FRASCO C/ 1 LITRO
    Descrição: CLOREXIDINA, GLICONATO 0,5% - SOLUÇÃO HIDROALCOOLICA - FRASCO C/ 1 LITRO REGISTRO. VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    4Frasco
    Produto/Serviço: ALCOOL ETÍLICO A 70% - FRASCO C/ 1 LITRO
    Descrição: ALCOOL ETILICO A 70%; CONCENTRACAO/DOSAGEM A 70%; FORMA DE APRESENTACAO EM FRASCO; FORMA FARMACEUTICA SOLUCAO; INDICACAO DE USO: ANTISSEPTICO, DESINFETANTE REGISTRO. VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    24Frasco
    Produto/Serviço: POVIDINE (PVPI) DEGERMANTE FRASCO C/ 1 LITRO
    Descrição: IODOPOLIVIDONA (PVPI) 10% (EQUIVALENTE A 1% DE IODO ATIVO), SOLUÇÃO DEGERMANTE, FRASCO C/ 1 LITRO. REGISTRO. VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    12Frasco
    Produto/Serviço: POVIDINE (PVPI) TÓPICO FRASCO C/ 1 LITRO
    Descrição: IODOPOLIVIDONA (PVPI) 10% (EQUIVALENTE A 1% DE IODO ATIVO), SOLUÇÃO AQUOSA (TÓPICO), FRASCO C/ 1 LITRO. REGISTRO. VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    6Frasco
    Produto/Serviço: AGUA OXIGENADA 10 VOLUMES FRASCO C/ 1 LITRO
    Descrição: AGUA OXIGENADA 10 VOLUMES FRASCO C/ 1 LITRO REGISTRO. VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    24Frasco
    Produto/Serviço: TINTURA DE IODO 10 % FRASCO C/ 1 LITRO
    Descrição: TINTURA DE IODO 10 % FRASCO C/ 1 LITRO VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    4Frasco
    Produto/Serviço: ÉTER COMERCIAL (REMOVEDOR) FRASCO C/ 1 LITRO
    Descrição: ÉTER COMERCIAL (REMOVEDOR) FRASCO C/ 1 LITRO COMPOSIÇÃO: ÉTER ETÍLICO 20% + ÁLCOOL ETÍLICO 80%. INDICAÇÃO DE USO: REMOVEDOR DE FITA ADESIVA E LIMPEZA DE RESÍDUO AUTOCOLANTE. REGISTRO. VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    12Frasco
    Produto/Serviço: CLOREXIDINA, GLICONATO 0,2% C/ PROPILENOGLICOL FRASCO C/ 1 LITRO
    Descrição: CLOREXIDINA, GLICONATO 2% C/ PROPILENOGLICOL FRASCO C/ 1 LITRO VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    2Frasco
    Produto/Serviço: VASELINA LÍQUIDA FRASCO C/ 1 LITRO
    Descrição: VASELINA LÍQUIDA FRASCO C/ 1 LITRO REGISTRO. VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    4Frasco
    Produto/Serviço: IODOPOLIVIDONA (PVPI TINTURA) 10% (EQUIVALENTE A 1% DE IODO ATIVO), SOLUÇÃO HIDROALCÓOLICA, ALMOTOLIA C/ 100ML.
    Descrição: IODOPOLIVIDONA (PVPI TINTURA) 10% (EQUIVALENTE A 1% DE IODO ATIVO), SOLUÇÃO HIDROALCÓOLICA, ALMOTOLIA C/ 100ML. REGISTRO. VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    72Frasco


    11227/2015
    28/05/2015 16:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Edital: 005/2015 Abertura de processo seletivo simplificado - 01 vaga de estagio, valor da bolsa R$ 788,00. Periodo: 01/04/2015 a 31/03/2016
    1Unidade


    11411/2015
    10/06/2015 16:00:00
    Processo Seletivo Simplificado Contratação de Outros Serviços

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Contratação de Pessoa Física
    Descrição: Contratação de Pessoa Física - Edital 006/2015 Abertura de processo seletivo simplificado - Auxiliar Administrativo R$ 942,00 + Ticket 440,00 + vale transporte.
    1Unidade


    11601/2015
    22/04/2015 16:00:00
    Dispensa de licitação Produtos Agropecuários
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: ração para Ema (Rhea Americana)
    Descrição: ração para Ema (Rhea Americana)
    500Quilograma


    11813/2015
    24/04/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: SERINGA (COMBITIPS) 1,25ML NAO ESTERIL 100/PCT REF. RB702372 - BRAND PONTEIRA PD-TIPS 1,25ml NÃO ESTÉRIL (P/DISPENS./REPIPETADORES MANUAIS TIPO HANDYSTEP) QUANTIDADE
    Descrição: SERINGA (COMBITIPS) 1,25ML NAO ESTERIL 100/PCT REF. RB702372 - BRAND PONTEIRA PD-TIPS 1,25ml NÃO ESTÉRIL (P/DISPENS./REPIPETADORES MANUAIS TIPO HANDYSTEP) QUANTIDADE
    1Pacote
    Produto/Serviço: SERINGA (COMBITIPS) 5ML NAO ESTERIL 100/PCT REF. RB702376 - BRAND PONTEIRA PD-TIPS 5ml NÃO ESTÉRIL (P/DISPENS./REPIPETADORES MANUAIS TIPO HANDYSTEP)
    Descrição: SERINGA (COMBITIPS) 5ML NAO ESTERIL 100/PCT REF. RB702376 - BRAND PONTEIRA PD-TIPS 5ml NÃO ESTÉRIL (P/DISPENS./REPIPETADORES MANUAIS TIPO HANDYSTEP)
    1Pacote
    Produto/Serviço: SERINGA (COMBITIPS) 12,5ML NAO ESTERIL 100/PCT REF. RB702378 - BRAND PONTEIRA PD-TIPS 12,5ml NÃO ESTÉRIL (P/DISPENS./REPIPETADORES MANUAIS TIPO HANDYSTEP)
    Descrição: SERINGA (COMBITIPS) 12,5ML NAO ESTERIL 100/PCT REF. RB702378 - BRAND PONTEIRA PD-TIPS 12,5ml NÃO ESTÉRIL (P/DISPENS./REPIPETADORES MANUAIS TIPO HANDYSTEP)
    1Pacote
    Produto/Serviço: SERINGA (COMBITIPS) 25ML NAO ESTERIL 50/PCT REF. RB702380 - BRAND PONTEIRA PD-TIPS 25ml NÃO ESTÉRIL (P/DISPENS./REPIPETADORES MANUAIS TIPO HANDYSTEP)
    Descrição: SERINGA (COMBITIPS) 25ML NAO ESTERIL 50/PCT REF. RB702380 - BRAND PONTEIRA PD-TIPS 25ml NÃO ESTÉRIL (P/DISPENS./REPIPETADORES MANUAIS TIPO HANDYSTEP)
    1Pacote


    11814/2015
    22/04/2015 00:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: livro de registros
    Descrição: 01 livro de registros capa preta.
    1Unidade
    Produto/Serviço: ácido acético
    Descrição: 02 frascos de ácido acético a 10 % de 500 ml cada.
    2Frasco


    11986/2015
    24/04/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Caixas organizadoras
    Descrição: Caixas organizadoras - 10 litros
    3Unidade
    Produto/Serviço: Bin
    Descrição: Bin (caçamba) número 5
    15Unidade


    12033/2015
    24/04/2015 15:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: kit de elisa
    Descrição: 1 kit de elisa. Kit para diagnóstico do Calazar canino (480 reações). ELISA/ S7.
    1Kit


    12115/2015
    22/04/2015 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: TEMPO DE PROTROMBINA (TP)
    Descrição: reagente - TEMPO DE PROTROMBINA (TP) - clot TP - 6 caixas com 10 frascos
    6Caixa
    Produto/Serviço: ggt
    Descrição: reagente - Gama gt - IFCC - Marca Kovalente
    3Caixa
    Produto/Serviço: micropote pirogalol (doles)
    Descrição: reagente - micropote pirogalol (doles)
    2Caixa
    Produto/Serviço: Albumina
    Descrição: reagente - Albumina WS Marca Kovalente
    1Frasco
    Produto/Serviço: proteínas totais
    Descrição: reagente - proteínas totais WS Marca Kovalente - 3 caixas com 6 frascos cada
    3Caixa


    12260/2015
    24/04/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Cassetes para histologia
    Descrição: 500 Cassetes para histologia (1 caixa)
    500Unidade
    Produto/Serviço: esparadrapo
    Descrição: esparadrapo
    4Rolo
    Produto/Serviço: Mini-tubo para coleta de sangue de 0,5ml em EDTA
    Descrição: 500 Mini-tubos para coleta de sangue de 0,5ml em EDTA
    500Frasco
    Produto/Serviço: Reagentes do pocH-100IV (diluente cel-pack)
    Descrição: Reagentes do pocH-100IV (diluente cel-pack) Roche
    1Litro
    Produto/Serviço: Eppendorf de 1,5ml de fundo cônico
    Descrição: Eppendorf de 1,5ml de fundo cônico
    5Saco
    Produto/Serviço: Sonda uretral n.4
    Descrição: Sonda uretral n.4
    40Unidade
    Produto/Serviço: Gaze não estéril
    Descrição: Gaze não estéril
    2Pacote
    Produto/Serviço: Tubo capilar
    Descrição: Tubo capilar
    10Caixa
    Produto/Serviço: Lamínula 24x33
    Descrição: Lamínula 24x33 ( 6 pacotes com 100 lamínulas)
    6Pacote


    12379/2015
    22/04/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Informática
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: impressora
    Descrição: Impressora térmica Zebra GC420T (GC420-1005A0-000) link do modelo e orçamento do produto http://www.hardstand.com.br/arquivos/6ff2c7c480ade3c5e14ba4e48ca53ca6
    1Unidade


    12624/2015
    22/04/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: primers
    Descrição: Oito pares de primers (16 frascos) com as especificações: Salmonella universal For 5'-GTGAAATTATCGCCACGTTCGGGCAA-3' Salmonella universal Rev 5'-TCATCGCACCGTCAAAGGAACC-3' Duck virus enteritis F ccagatgctctgaacctatataag Duck virus enteritis R gagtgtgtgctctaatgagacga Psittacine adenovirus F 5-atgggagcsacctayttcgacat-3 Psittacine adenovirus R 5-aaattgtccckraanccgatgta-3 BFDV Forward AACCCTACAGACGGCGAG BFDV Reverse GTCACAGTCCTCCTTGTACC Amy Kistler Avian Bornavirus Forward GGRCAAGGTAATYGTYCCTGGATGGCC Amy Kistler Avian Bornavirus Reverse CCAACAACAATETTCCGAAGMGCG Fav-Hexon Adenovirus Universal Forward 5'-AACGTCAATCCCTTCAACCACC-3' Fav-Hexon Adenovirus Universal Reverse 5'-TTGCCTGTGGCGAAAGGCG-3' Mg OIE F 5'- GAG CTA ATC TGT AAA GTT GGT C -3' Mg OIE R 5'-GCT TCC TTG CGG TTA GCA AC -3' Marek's Disease MEG gene F ATGTCTCAGGAGCCAGAGCCGGGCGCT Marek's Disease MEG gene R GGGGCATAGACGATGTGCTTGCTGAG
    16Frasco


    12804/2015
    24/04/2015 16:00:00
    Dispensa de licitação Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: serviço manutenção microscópio NIKON mod. YS-T
    Descrição: serviço manutenção microscópios NIKON mod. YS-T
    5Unidade
    Produto/Serviço: serviço manutenção microscópio OLYMPUS serie CH
    Descrição: serviço manutenção microscópios OLYMPUS serie CH
    2Unidade
    Produto/Serviço: serviço manutenção microscópio MICRONAL
    Descrição: serviço manutenção microscópio estereoscópio binocular MICRONAL.
    1Unidade


    12845/2015
    22/04/2015 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Gaze queijo
    Descrição: Gaze queijo (rolos) de 9 fios, 91 cm x 91 m) (total 3 rolos)
    3Rolo
    Produto/Serviço: Bálsamo do Canadá
    Descrição: Bálsamo do Canadá Sintético de 100 ml (Synth)
    3Frasco
    Produto/Serviço: papel toalha fardo
    Descrição: Papel toalha fardo, interfolhadas, descartáveis, 02 dobras, papel com 100% de celulose virgem, formato 23 x 20 cm, Premium, brancas (5 fardos)
    5Fardo
    Produto/Serviço: lamínulas de vidro
    Descrição: Lamínulas de vidro de primeira linha, 24 x 40 mm, 100 pcs/box - 0,13-0,16 mm thick da referencia da marca Kasvi (cover glass - K5-2440) (total pedido 20 caixas com 100 cada)
    20Caixa
    Produto/Serviço: xilol
    Descrição: Xilol p.a./ACS 100% - 1000 ml (860G), de preferência marca Synth (total 50 litros)
    50Litro
    Produto/Serviço: parafina
    Descrição: Parafina histológica granulada, faixa de fusão entre 58 a 62oC, marca preferivel Snth (pedido 50 quilos)
    50Quilograma
    Produto/Serviço: papel filtro
    Descrição: Papel filtro qualitativo, em formato circular, cor branca, 33 cm de diâmetro, pacote com 100 unidades
    1Pacote
    Produto/Serviço: formol
    Descrição: Formol 37% de 5 litros (20 frascos)
    20Frasco
    Produto/Serviço: pinça
    Descrição: Pinça reta para dissecação de 15 cm (8 pinças)
    8Unidade
    Produto/Serviço: pinça
    Descrição: Pinça Dente de Rato de 15 cm (8 pinças)
    8Unidade
    Produto/Serviço: faca
    Descrição: Faca reta, referencia cod. 5515-6
    4Unidade
    Produto/Serviço: Hematoxilina
    Descrição: Hematoxilina de Harris de 500 ml, cod 1328/New Prov. (4 frascos)
    4Frasco
    Produto/Serviço: berço de vidro p/ coloração de lâminas
    Descrição: Berço de porta lâminas de vidro com alça inox, tamanho 88 x 40 x 70 mm (referencia 9131700)
    5Unidade
    Produto/Serviço: tesoura
    Descrição: Tesoura ponta fina-fina de 15 cm, marca Edlo (se possível)
    4Unidade
    Produto/Serviço: tesoura
    Descrição: Tesoura ponta fina-romba de 15 cm marca Edlo (se possível)
    4Unidade


    13081/2015
    23/04/2015 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Informática
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Bandeja de documentos
    Descrição: BANDEJA DOCUMENTOS - TIPO TRIPLA - MATERIAL ACRILICO CINZA
    10Unidade
    Produto/Serviço: cartucho
    Descrição: CARTUCHO IMPRESSORA REF C9385AL - TINTA PRETA
    2Unidade
    Produto/Serviço: cartucho
    Descrição: CARTUCHO IMPRESSORA REF C9388AL - TINTA AMARELA
    2Unidade
    Produto/Serviço: caneta
    Descrição: CANETA ESFEROGRAFICA - AZUL/PONTA MÉDIA - CAIXA COM 50 UNIDADES
    10Caixa
    Produto/Serviço: caneta
    Descrição: CANETA ESFEROGRAFICA - VERMELHA/PONTA MÉDIA - CAIXA COM 50 UNIDADES
    6Caixa
    Produto/Serviço: caneta
    Descrição: CANETA ESFEROGRAFICA - PRETA/PONTA MÉDIA - CAIXA COM 50 UNIDADES
    10Caixa
    Produto/Serviço: Colchete
    Descrição: COLCHETE LATONADO MÉDIO NUM 7
    15Caixa
    Produto/Serviço: Colchete
    Descrição: COLCHETE LATONADO MÉDIO NUM 8
    15Caixa
    Produto/Serviço: Toner HP
    Descrição: TONER IMPRESSORA - HP LASERJET 2600N COR AMARELA - CARTUCHO Q6002A
    2Unidade
    Produto/Serviço: Toner HP
    Descrição: TONER IMPRESSORA - HP LASERJET 2600N COR CIANO - CARTUCHO Q6001A
    1Unidade
    Produto/Serviço: Toner HP
    Descrição: TONER IMPRESSORA - HP LASERJET 2600N COR MAGENTA - CARTUCHO Q6003A
    2Unidade
    Produto/Serviço: Toner HP
    Descrição: TONER IMPRESSORA - HP LASERJET 2600N PRETA - CARTUCHO Q6000A
    2Unidade
    Produto/Serviço: fita adesiva
    Descrição: FITA ADESIVA DUPLA FACE - MATERIAL PAPEL, LARGURA 25 MM, COMP. 30 M, COR BRANCA
    30Unidade
    Produto/Serviço: fita transparente adesiva
    Descrição: FITA ADESIVA TRANSPARENTE 12MM - ROLO 33 METROS
    20Unidade
    Produto/Serviço: fita transparente adesiva
    Descrição: FITA ADESIVA TRANSPARENTE 19MM - ROLO 50 METROS
    60Unidade
    Produto/Serviço: FLANELA
    Descrição: FLANELA - USO GERAL - COR AMARELA
    50Unidade
    Produto/Serviço: grampeador
    Descrição: GRAMPEADOR DE MESA PARA GRAMPO 26/6 - CAPACIDADE 12 FOLHAS
    30Unidade
    Produto/Serviço: grampeador
    Descrição: GRAMPEADOR - GRANDE - CAPACIDADE NO MÍNIMO 110 FOLHAS
    10Unidade
    Produto/Serviço: papel
    Descrição: PAPEL APERGAMINHADO BRANCO - FORMATO A4 - PCT COM 500 FOLHAS
    200Pacote
    Produto/Serviço: PAPEL
    Descrição: PAPEL VERGE - COR MARFIM - PCT 50 FOLHAS - GRAMATURA 180
    20Pacote
    Produto/Serviço: pasta suspensa marmorizada
    Descrição: PASTA SUSPENSA - MATERIAL CARTÃO HORLLE
    300Unidade
    Produto/Serviço: Pasta
    Descrição: PASTA PAPEL CARTÃO DUPLO 580G/M2, PLASTIFICADA EXTERNA COM ABAS DOBRÁVEIS E ELÁSTICOS NA COR CINZA.
    600Unidade
    Produto/Serviço: caneta marcadora para retroprojetor azul
    Descrição: PINCEL MARCADOR DE TRANSPARÊNCIA - COR AZUL - PONTA 0,01 ML
    18Peça
    Produto/Serviço: caneta marcadora para retroprojetor preta
    Descrição: PINCEL MARCADOR DE TRANSPARÊNCIA - COR PRETO - PONTA 0,01 ML
    18Peça
    Produto/Serviço: caneta marcadora para retroprojetor vermelho
    Descrição: PINCEL MARCADOR DE TRANSPARÊNCIA - COR VERMELHO - PONTA 0,01 ML
    12Peça
    Produto/Serviço: SACO PLÁSTICO
    Descrição: SACO PLÁSTICO - COM FUROS - COM ESPESSURA DE 12 MICRAS - PACOTE COM 100
    50Pacote
    Produto/Serviço: TONER IMPRESSORA LASER REF CE255A
    Descrição: TONER IMPRESSORA LASER REF CE255A
    3Unidade
    Produto/Serviço: TONER IMPRESSORA LASER REF MLT D104S
    Descrição: TONER IMPRESSORA LASER REF MLT D104S
    10Unidade
    Produto/Serviço: TONER IMPRESSORA REF MLT-D116S - D116S
    Descrição: TONER IMPRESSORA REF MLT-D116S - D116S
    6Unidade
    Produto/Serviço: UNIDADE DE IMAGEM PARA IMPRESSORA SANSUNG MODEL. MLT-R116/XAZ
    Descrição: UNIDADE DE IMAGEM PARA IMPRESSORA SANSUNG MODEL. MLT-R116/XAZ
    2Unidade


    13174/2015
    24/04/2015 00:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Camera Infravermelho digital 800 linhas LEDS IR CUT para 30 metros
    Descrição: Camera Infravermelho digital 800 linhas LEDS IR CUT para 30 metros
    8Peça
    Produto/Serviço: Fonte de alimentação estabilizada 12 volts - 5 ampéres
    Descrição: Fonte de alimentação estabilizada 12 volts - 5 ampéres
    4Unidade
    Produto/Serviço: Gravador digital Stand Alone 08 canais com HD de 01 Tera Byte
    Descrição: Gravador digital Stand Alone 08 canais com HD de 01 Tera Byte
    1Unidade
    Produto/Serviço: Filtro de linha com 08 saídas para organização de tomadas
    Descrição: Filtro de linha com 08 saídas para organização de tomadas
    1Unidade
    Produto/Serviço: Cabo manga 04 vias para CFTV
    Descrição: Cabo manga 04 vias para CFTV
    300Metro
    Produto/Serviço: Conectores BNC e P4 de BORNE
    Descrição: Conectores BNC e P4 de BORNE
    24Unidade
    Produto/Serviço: Caixa Plástica Tigre 40 x 40 para organização de cabos e fixação de DVR
    Descrição: Caixa Plástica Tigre 40 x 40 para organização de cabos e fixação de DVR
    1Peça
    Produto/Serviço: Monitor tela plana de LCD 22 polegadas
    Descrição: Monitor tela plana de LCD 22 polegadas
    1Unidade


    13357/2015
    22/04/2015 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: pipeta sorológica 1 ml
    Descrição: Pipeta Sorológica 1 ml Código: 86.1251.001 Marca: Sarstedt Utilizamos dessa marca devido aos bons resultados obtidos em nosso laboratório
    3Pacote
    Produto/Serviço: Pipeta Sorológica 2ml
    Descrição: Pipeta sorológica de 2ml - Código: 86.1252.001 Marca: Sarstedt Utilizamos dessa marca devido aos bons resultados obtidos em nosso laboratório
    2Unidade
    Produto/Serviço: pipeta sorológica 5ml
    Descrição: pipeta sorológica 5ml Código: 86.1253.001 Marca: Sarstedt Utilizamos dessa marca devido aos bons resultados obtidos em nosso laboratório
    10Pacote
    Produto/Serviço: pipeta sorológica 10ml
    Descrição: pipeta sorológica 10ml Código: 86.1254.001 Marca: Sarstedt Utilizamos dessa marca devido aos bons resultados obtidos em nosso laboratório
    6Pacote
    Produto/Serviço: pipetas sorológica 25ml
    Descrição: pipetas sorológicas 25 ml Código: 86.1685.001 Marca: Sarstedt Utilizamos dessa marca devido aos bons resultados obtidos em nosso laboratório
    12Pacote
    Produto/Serviço: reservatório para cultivo de celula T25
    Descrição: reservatório para cultivo de celula T25 Código: 83.1810 Marca: Sarstedt Utilizamos dessa marca devido aos bons resultados obtidos em nosso laboratório
    1Caixa
    Produto/Serviço: reservatório para cultivo de celula T175
    Descrição: reservatório para cultivo de celula T175 Código: 83.1812 Marca: Sarstedt Utilizamos dessa marca devido aos bons resultados obtidos em nosso laboratório
    2Caixa
    Produto/Serviço: Cell Scrapper
    Descrição: Cell scrapper para raspagem de células. Código: 83.1830 Marca: Sarstedt Utilizamos dessa marca devido aos bons resultados obtidos em nosso laboratório
    2Caixa
    Produto/Serviço: placa de cultura 24 wells
    Descrição: placa de cultura 24 wells Código: 83.1836 Marca: Sarstedt Utilizamos dessa marca devido aos bons resultados obtidos em nosso laboratório
    1Caixa
    Produto/Serviço: lâmínulas de vidro
    Descrição: lâmínulas de vidro (coverslips) 13mm estéril. Código: 83.1840.002 Marca: Sarstedt Utilizamos dessa marca devido aos bons resultados obtidos em nosso laboratório
    10Caixa
    Produto/Serviço: tubo tipo falcon 50ml estéril
    Descrição: tubo tipo falcon 50ml estéril, não pirogênico. Código: 62.547205 Marca: Sarstedt Utilizamos dessa marca devido aos bons resultados obtidos em nosso laboratório
    1Caixa


    13360/2015
    22/04/2015 00:00:00
    Dispensa de licitação Contratação de Outros Serviços
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Manutenção corretiva de equipamento de monitorização - Modulos Dixtal
    Descrição: Manutenção corretiva de equipamento de monitorização - Modulos Dixtal
    1Unidade


    13497/2015
    24/04/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Tiras Lactato cx. com 25 unidades - Roche
    Descrição: Tiras Lactato cx. com 25 unidades - Roche
    1Unidade


    13498/2015
    23/04/2015 00:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Accutrend Plus Roche - Aparelho Monitor - Lactímetro
    Descrição: Accutrend Plus Roche - Aparelho Monitor - Lactímetro
    1Unidade


    13507/2015
    21/04/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: SULFADIAZINA DE PRATA 0.1G (BACTROVET/AEROCID) - AEROSOL 500ML
    Descrição: SULFADIAZINA DE PRATA 0.1G (BACTROVET/AEROCID) - AEROSOL 500ML VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE REGISTRO MS/MAPA
    10Frasco
    Produto/Serviço: OXITETRACICLINA, CLORIDRATO LA - FRASCO C/ 50 ML(TERRAMICINA/ BIOGENTAL)
    Descrição: OXITETRACICLINA, CLORIDRATO LA - FRASCO C/ 50 ML(TERRAMICINA/ BIOGENTAL) VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE REGISTRO MS/MAPA
    5Frasco
    Produto/Serviço: RIFAMICINA SODICA - 10 MG/ML - SPRAY
    Descrição: RIFAMICINA SODICA - 10 MG/ML - SPRAY REGISTRO MS/ANVISA VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE DO PRODUTO
    20Frasco


    13508/2015
    22/04/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: DOXORRUBICINA, CLORIDRATO 10MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA
    Descrição: DOXORRUBICINA, CLORIDRATO 10MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA REGISTRO MS/ANVISA VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE DO PRODUTO
    15Frasco
    Produto/Serviço: EPIRRUBICINA, CLORIDRATO 10MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA C/ DILUENTE
    Descrição: EPIRRUBICINA, CLORIDRATO 10MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA C/ DILUENTE REGISTRO MS/ANVISA VALIDADE MÍNIMA DE 75% DO PRAZO DE VALIDADE DO PRODUTO
    4Frasco
    Produto/Serviço: GENCITABINA 200MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA
    Descrição: GENCITABINA 200MG PÓ LIÓFILO P/ SOLUÇÃO INJETÁVEL FRASCO AMPOLA REGISTRO MS/ANVISA VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE DO PRODUTO
    10Frasco


    13514/2015
    21/04/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: ETHANOL HPLC Grade/200 Proof - 1Litro - C. 459828
    Descrição: ETHANOL HPLC Grade/200 Proof - 1Litro - C 459828
    1Frasco
    Produto/Serviço: ORGANIC SOLVANT STANDARD SOLUTION -250ml - C 19182
    Descrição: ORGANIC SOLVANT STANDARD SOLUTION -250ml - C 19182
    1Frasco


    13515/2015
    22/04/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: AMOXICILINA 1000MG + ÁCIDO CLAVULÂNICO 200MG - PÓ INJETÁVEL
    Descrição: AMOXICILINA 1000MG + ÁCIDO CLAVULÂNICO 200MG - PÓ INJETÁVEL VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE
    100Frasco
    Produto/Serviço: METRONIDAZOL SOLUÇÃO INJETÁVEL 5MG/ML - FRASCO C/ 100ML
    Descrição: METRONIDAZOL SOLUÇÃO INJETÁVEL 5MG/ML - FRASCO C/ 100ML VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE
    160Frasco
    Produto/Serviço: METILPREDNISOLONA, ACETATO 20MG/ML (CORTI-DURAL) - FRC C/ 5ML
    Descrição: METILPREDNISOLONA, ACETATO 20MG/ML (CORTI-DURAL) - FRC C/ 5ML VALIDADE DE NO MÍNIMO 75% DA VALIDADE DO PRODUTO
    2Frasco
    Produto/Serviço: PROPOFOL 10MG/ML FRASCO C/ 20ML (PROPOVAN) - CRISTÁLIA
    Descrição: PROPOFOL 10MG/ML FRASCO C/ 20ML (PROPOVAN) LABORATÓRIO: CRISTÁLIA VALIDADE DE NO MÍNIMO 01 ANO PARCELADO DE 02 VEZES
    300Frasco
    Produto/Serviço: DOBUTAMINA 12,5MG/ML - AMPOLA 20ML SOLUÇÃO INJETÁVEL
    Descrição: DOBUTAMINA 12,5MG/ML - AMPOLA 20ML SOLUÇÃO INJETÁVEL VALIDADE DE NO MÍNIMO 01 ANO
    50Ampola
    Produto/Serviço: CLORETO DE POTÁSSIO 10% AMPOLA 10ML
    Descrição: CLORETO DE POTÁSSIO 10% AMPOLA 10ML VALIDADE DE NO MÍNIMO 01 ANO
    200Ampola
    Produto/Serviço: FUROSEMIDA SOLUÇÃO INJETÁVEL 10 MG/ML AMPOLA 10ML
    Descrição: FUROSEMIDA SOLUÇÃO INJETÁVEL 10 MG/ML AMPOLA 10ML VALIDADE DE NO MÍNIMO 01 ANO
    100Ampola
    Produto/Serviço: VITAMINA K (FITOMETADIONA) 10 MG/ML - AMPOLA C/ 1ML
    Descrição: VITAMINA K (FITOMETADIONA) 10 MG/ML - AMPOLA C/ 1ML VALIDADE DE NO MÍNIMO 01 ANO
    50Ampola


    13516/2015
    22/04/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: MAROPITANT, CITRATO 10MG/ML - 20ML (CERENIA) FRASCO
    Descrição: MAROPITANT, CITRATO 10MG/ML - 20ML (CERENIA) FRASCO VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE
    10Frasco


    13550/2015
    22/04/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: café 500gr
    Descrição: Café Tres Corações tradicional, pacote com 500gr
    40Pacote
    Produto/Serviço: Açucar
    Descrição: Açúcar cristal pacote com 5 kg
    10Saco


    13553/2015
    22/04/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: ADRENALINA 1MG - AMPOLA C/ 1 ML, CAIXA COM 100 UNIDADES
    Descrição: ADRENALINA 1MG - AMPOLA C/ 1 ML. CAIXA COM 100 UNIDADES REGISTRO ANVISA. VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    2Caixa
    Produto/Serviço: CEFALOTINA SÓDICA 1G - PÓ LIOFILO. CAIXA COM 100 FRASCO-AMPOLA.
    Descrição: CEFALOTINA SÓDICA 1G - PÓ LIOFILO. CAIXA COM 100 FRASCO-AMPOLA. REGISTRO ANVISA. VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    2Caixa
    Produto/Serviço: HIOSCINA,BUTILBROMETO 4MGML +DIPIRONA(BUSCOPAN COMPOSTO) - AMPOLA C/5ML. CAIXA COM 100 AMPOLAS.
    Descrição: HIOSCINA,BUTILBROMETO 4MGML +DIPIRONA(BUSCOPAN COMPOSTO) - AMPOLA C/5ML. CAIXA COM 100 AMPOLAS REGISTRO ANVISA. VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    2Caixa
    Produto/Serviço: RANITIDINA 25MG/ML - AMPOLA COM 2ML. CAIXA COM 120 UNIDADES.
    Descrição: RANITIDINA 25MG/ML - AMPOLA COM 2ML. CAIXA COM 120 UNIDADES. CAIXA C/120 AMPOLAS. REGISTRO ANVISA. VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE APÓS ENTREGA NA FARMÁCIA
    2Caixa


    13554/2015
    23/04/2015 00:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: PATE A/D - LATA
    Descrição: PATE A/D - LATA.
    192Lata


    13555/2015
    21/04/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Roupa
    Descrição: : Roupa pós-cirúrgica, número 2, unissex para proteção após castração, retirada de tumor, cirurgia de estômago, operação cesária, etc. Confeccionada em malha canelada, com fechecler o dorso. Largura do pescoço até o início da cauda aproximadamente 26 cm. Branco, relação do diâmetro peitoral de aproximadamente 12 cm
    5Unidade
    Produto/Serviço: Roupa
    Descrição: Roupa pós-cirúrgica, número 4, unissex para proteção após castração, retirada de tumor, cirurgia de estômago, operação cesária, etc. confeccionada em malha canelada, com fechecler o dorso. Largura do pescoço até o início da cauda aproximadamente 28 cm. Branco, relação do diâmetro peitoral de aproximadamente 15 cm
    15Unidade
    Produto/Serviço: Roupa
    Descrição: Roupa pós-cirúrgica, número 6, unissex para proteção após castração, retirada de tumor, cirurgia de estômago, operação cesária, etc. confeccionada em malha canelada, com fechecler o dorso. Largura do pescoço até o início da cauda aproximadamente 31 cm. Branco, relação do diâmetro peitoral de aproximadamente 18 cm
    8Unidade
    Produto/Serviço: Roupa
    Descrição: : Roupa pós-cirúrgica, número 10, unissex para proteção após castração, retirada de tumor, cirurgia de estômago, operação cesária, etc. confeccionada em malha canelada, com fechecler o dorso. Largura do pescoço até o início da cauda aproximadamente 38,50 cm. Branco, relação do diâmetro peitoral de aproximadamente 24 cm
    8Unidade
    Produto/Serviço: Roupa
    Descrição: Roupa pós-cirúrgica, tamanho G, unissex para proteção após castração, retirada de tumor, cirurgia de estômago, operação cesária, etc. confeccionada em malha canelada, com fechecler o dorso. Largura do pescoço até o início da cauda aproximadamente 45,50 cm. Branco, relação do diâmetro peitoral de aproximadamente 26 cm
    3Unidade
    Produto/Serviço: Roupa
    Descrição: Roupa pós-cirúrgica, tamanho GG, unissex para proteção após castração, retirada de tumor, cirurgia de estômago, operação cesária, etc. confeccionada em malha canelada, com fechecler o dorso. Largura do pescoço até o início da cauda aproximadamente 51 cm. Branco, relação do diâmetro peitoral de aproximadamente 31 cm
    6Unidade
    Produto/Serviço: Roupa
    Descrição: Roupa pós-cirúrgica, número 2, unissex para proteção ESPECIAL PARA ANIMAIS MASTECTOMIZADOS confeccionada em malha canelada, com fechecler o dorso.
    8Unidade
    Produto/Serviço: Roupa
    Descrição: Roupa pós-cirúrgica, número 4, unissex para proteção ESPECIAL PARA ANIMAIS MASTECTOMIZADOS confeccionada em malha canelada, com fechecler o dorso. Largura do pescoço até o início da cauda aproximadamente 28 cm. Branco, relação do diâmetro peitoral de aproximadamente 16 cm
    8Unidade
    Produto/Serviço: Roupa
    Descrição: Roupa pós-cirúrgica, número 6, unissex para proteção ESPECIAL PARA CÃES MASTECTOMIZADOS, confeccionada em malha canelada, com fechecler o dorso. Largura do pescoço até o início da cauda aproximadamente 31 cm. Branco, relação do diâmetro peitoral de aproximadamente 18 cm
    8Unidade
    Produto/Serviço: Roupa
    Descrição: Roupa pós-cirúrgica, tamanho G, unissex para proteção ESPECIAL PARA CÃES MASTECTOMIZADOS etc. confeccionada em malha canelada, com fechecler o dorso.
    3Unidade


    13556/2015
    21/04/2015 16:00:00
    Pregão eletrônico Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: MALHA TUBULAR ORTOPÉDICA COM 40CM LARGURA X 15M COMPRIMENTO.
    Descrição: MALHA TUBULAR ORTOPÉDICA COM 40CM LARGURA X 15M COMPRIMENTO. MARCA SUGERIDA: POLARFIX
    2Rolo
    Produto/Serviço: MALHA TUBULAR ORTOPÉDICA COM 30CM LARGURA X 15M COMPRIMENTO.
    Descrição: MALHA TUBULAR ORTOPÉDICA COM 30CM LARGURA X 15M COMPRIMENTO. MARCA SUGERIDA: POLARFIX
    2Rolo


    13557/2015
    21/04/2015 16:00:00
    Dispensa de licitação Outras Compras
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Fio cirúrgico Vicryl 0
    Descrição: Fio cirúrgico Vicryl 0 - fio do poligalctina 910 tamanho 0; com 70cm comprimento, agulha tipo atraumática de 65mm de comprimento e formato 1/2 círculo. 72 unidades (3 caixas com 24 unidades)
    72Unidade
    Produto/Serviço: Fio cirúrgico Vicryl 1
    Descrição: Fio cirúrgico Vicryl 1 - fio do poligalctina 910 tamanho 0; com 90cm comprimento, agulha tipo atraumática de 48mm de comprimento e formato 1/2 círculo. 72 unidades (3 caixas com 24 unidades).
    72Unidade


    13561/2015
    21/04/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Informática
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: teclado
    Descrição: Teclados simples, para computador, com cabo (conector) USB
    10Unidade


    13599/2015
    21/04/2016 16:00:00
    Pregão eletrônico Outras Compras

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: Material de Consumo
    Descrição: Material Hospitalar - Licitação 002/2015
    1Unidade


    13677/2015
    22/04/2015 16:00:00
    Dispensa de licitação Equipamentos/Produtos de Laboratório
    Nenhum item encontrado.

    Produto/ServiçoQuant.Unidade
    Produto/Serviço: RNALATER
    Descrição: RNALATER, 500ML; AM7021
    0,5Litro