ÁREA DO FORNECEDOR

ACESSO RESTRITO












Destaques


A FEPE recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
11464/2022
12/08/2022 16:00:00
Dispensa de licitação
579/2022 Contratação de Outros Serviços
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Software para o Sistema de Gestão da Qualidade Módulos: Gestão de Documentos Gestão de Não Conformidades e Plano de Ação
Descrição: Software para o Sistema de Gestão da Qualidade Módulos: Gestão de Documentos Gestão de Não Conformidades e Plano de Ação Idioma: português (mínimo) Espaço ilimitado em banco de dados Atualizações e melhorias em tempo real sem custo Suporte ilimitado e sem custo (telefone, e-mail, video conferência, chat, etc) Treinamento (online ou no local) para uso dos módulos de gestão 10 usuários
24Mês
Produto/Serviço: Contratação de módulo adicional do SISLAB Módulo de Gestão da qualidade do leite de Rebanhos
Descrição: O módulo de rebanhos SISLAB permitirá análise de rebanhos com aspectos básicos de qualidade de leite e mastite, não incluindo aspectos genéticos, nutrição e outros.
24Mês


11931/2022
12/08/2022 16:00:00
Dispensa de licitação
586/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: bisturi
Descrição: Descrição do produto: •Painel de membrana blindado à prova de líquidos com teclas Soft Touch; •Display digital para indicação da potência; •Potência máxima de saída: 120 watts; •Precisão de 1watt para cada modo de operação; •6 modos de operação: CUT PURO, BLEND 1, BLEND 2, BLEND 3, COAG PURO e BIPOLAR •Memória independente para cada modo de operação; •Novo Sistema MegapulseNEO: Duas funções de controle de energia eletromagnética, micropulsada (ms) ou pulsada (Hz). Seis modos de operação contínuos e seis modos de operação pulsados* (doze funções) com algoritmo que permite mais de 200 opções de combinações para microcirurgias de precisão; •Pedal de acionamento Duplo CUT/COAG à prova d'água (grau de proteção IPX7); •Duas opções de canetas porta eletrodo: com comando manual ou comando por pedal; •Activation Counter – Exibe quantas vezes o equipamento foi utilizado; •Sinalização áudio visual de ativação com duplo tom – CUT (agudo) / COAG (grave); •Controle do volume do sinal de ativação; •Tecnologia MQC: Monitoramento da qualidade de contato da Placa Neutra com bloqueio automático do Equipamento em caso de falha de contato ou falta de conexão (continuidade) da Placa Neutra; •Sinal áudio visual em caso de falha ou falta da Placa Neutra; •Três opções de Placas Neutras: Reutilizável em aço inox, adesiva descartável simples e adesiva descartável bipartida (Tecnologia MQC); •Wavevac Dual: Controle remoto de ativação do aspirador de vapores, com LED indicador no painel; •Bivolt automático 115/230VAC – 50Hz a 60Hz; •Frequência de trabalho: 490kHz; •Dimensões: Alt.: 133mm, Larg.: 243mm, Prof.: 325mm Peso: 5,24kg; •Grau de proteção contra choque elétrico (Classe I); •Grau de proteção contra líquidos (IPX1); * Quando conectado ao MegapulseNEO Acessórios: •Caneta Porta Eletrodos autoclavável e reutilizável com cabo de silicone de 03 metros; •Placa neutra em Inox Reutilizável; •Cabo de Placa neutra de 03 metros com Clipe Conector para todas as opções de placas; •Pedal Duplo de acionamento CUT/COAG com cabo de 03 metros; •Cabo de alimentação elétrica (padrão ABNT); •7 eletrodos** autoclaváveis reutilizáveis (ver site com mais de 1000 opções);
1Unidade


12909/2022
12/08/2022 16:00:00
Dispensa de licitação
623/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Filtro de drenagem do tanque
Descrição: Filtro de drenagem do tanque Especificação técnica: - Marca do equipamento: Medisafe SI digital pct - MED1132.1 SI Digital
30Unidade


20255/2022
15/08/2022 16:00:00
Dispensa de licitação
952/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ATROPINA, SULFATO 0,25 MG/ML - AMPOLA C/ 1 ML AMP -IV
Descrição: ATROPINA, SULFATO 0,25 MG/ML - AMPOLA C/ 1 ML AMP -IV . MEDICAMENTO COM REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA NA FARMÁCIA
100Ampola


21191/2022
15/08/2022 12:00:00
Dispensa de licitação
1007/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: caneta
Descrição: Descrição: Caneta monopolar de comando pedal com eletrodo para eletrocautério, com plugue universal de 01 pino, •Controle através de pedal que aciona as funções de corte e coagulação. •Caneta Padrão Autoclavável •Mandril para eletrodos de Ø 1,6 mm a Ø 2,38 mm •Cabo fixo de silicone com 3,0 metros. Conector isolado com pino Ø 3,97 mm para conexão com o bisturi. •Registro ANVISA/MS •Constituídas por corpo, plugue e ponta em poliacetal; mandril em latão cromado para encaixe dos eletrodos e cabo de silicone de 4,0 mm x 3,0m de comprimento. Aceitam eletrodos com hastes entre Ø 1,6 mm a Ø 2,38 mm, oferecendo versatilidade para os procedimentos gerais de eletrocirurgia. Potência de até 400 watts. Solicita-se envio de fotos da caneta orçada.
5Unidade


21309/2022
12/08/2022 16:00:00
Dispensa de licitação
1014/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FILTRO ANTIBACTERIANO DE 0,2 MICRONS
Descrição: FILTRO ANTIBACTERIANO DE 0,2 MICRONS Embalagem unitária contendo número de lote, data fabricação e validade. Registro na Anvisa/M
50Unidade


22163/2022
12/08/2022 15:00:00
Dispensa de licitação
1049/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: IOEXOL 300 MG/ML FR. AMPOLA C/ 50 ML SOLUÇÃO INJETÁVEL (OMNIPAQUE)
Descrição: IOEXOL 300 MG/ML FR. AMPOLA C/ 50 ML SOLUÇÃO INJETÁVEL (OMNIPAQUE). REGISTRO ANVISA. PRAZO DE VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA.
20Frasco


23077/2022
13/08/2022 08:00:00
Dispensa de licitação
1086/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AMOXICILINA 14G/100ML +CLAVULANATO DE POTÁSSIO 3,5G/100ML FRASCO C/ 50 ML (MEDICAMENTO VETERINÁRIO)
Descrição: MEDICAMENTO VETERINÁRIO AMOXICILINA 14G/100ML +CLAVULANATO DE POTÁSSIO 3,5G/100ML FRASCO C/ 50 ML REGISTRO NO MAPA/MS. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA NA FARMÁCIA. SUGESTÃO DE MARCA: CLAVACILIN
5Frasco


23096/2022
13/08/2022 19:00:00
Dispensa de licitação
1092/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Calibração dos pesos utilizados para verificação da balança COM CERTIFICADO RBC
Descrição: Acondicionadas em estojo individual de PVC, madeira ou similar. Com certificado de calibração com símbolo da acreditação RBC e etiqueta de calibração RBC para afixar no estojo do equipamento. Com número de série gravado de forma indelével no estojo do instrumento pelo fabricante ou pelo laboratório de calibração. Prazo calibração: 5 anos. Classe da massa: F1. Valor nominal: 1 g. Classe da massa: F1. Valor nominal: 10 g. Classe da massa: F1. Valor nominal: 50 g. MANUSEIO DE MASSA: Pinça antimagnética com ponta revestida. Luvas de algodão. Material de limpeza: solução de limpeza e tecido adequado para limpeza. Para verificações da balança Shimadzu, resolução 0,00001 g, na faixa de 0,00100 g a 80,00000 g. Erro Máximo Admissível para a classe F1 (EMA) ¦E¦+ U = EMA Valor nominal: 1 g EMA = 0,10 mg U aceitável = 0,05 mg Valor nominal: 10 g EMA = 0,20 mg U aceitável = 0,10 mg. Valor nominal: 50 g EMA = 0,60 mg U aceitável = 0,30 mg Número de série. Classe da massa. TAG do laboratório. Símbolo da acreditação. Dados requeridos no item 7.8 da ABNT NBR ISO\IEC 17025:2017. Massa de referência Valor nominal: 1 g E = 0,05 mg Incerteza máxima esperada pelo LabUFMG = 0,05 mg Valor nominal: 10 g E = 0,10 mg Incerteza máxima esperada pelo LabUFMG = 0,10 mg Valor nominal: 50 g E = 0,30 mg Incerteza máxima esperada pelo LabUFMG = 0,30 mg Serviço prestado na instalação do fornecedor.
3Unidade


23800/2022
31/08/2022 16:00:00
Processo Seletivo Simplificado
12/2022 Equipamentos/Produtos de Laboratório
EDITAL SELEÇÃO PÚBLICA Nº 006/2022 FEPE !
AVISO DE PRORROGAÇÃO, EDITAL SELEÇÃO PÚBLICA 006_2022_FEPE !

Produto/ServiçoQuant.Unidade
Produto/Serviço: APARELHO DE TOMOGRAFIA COMPUTADORIZADA, COM O REGISTRO ANVISA VALIDO, O SISTEMA DE TOMOGRAFIA COMPUTADORIZADA DEVERÁ SER COMPOSTO POR GANTRY, MESA COM CAPACIDADE DE SUPORTAR 200KG, SISTEMA DE PROCESSAMENTO, MONITOR.
Descrição: A presente Seleção Pública tem como objeto a contratação de empresa especializada em fornecimento de equipamento seminovo, não sendo admitida a apresentação de equipamento restaurado ou afim, com as especificações mínimas contidas no Termo de Referência – Anexo I
1Unidade


24100/2022
16/08/2022 16:00:00
Dispensa de licitação
1163/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ERITROPOETINA 400MG, PÓ LIÓFILO, FRASCO-AMPOLA
Descrição: ERITROPOETINA 400MG, PÓ LIÓFILO, FRASCO-AMPOLA MEDICAMENTO COM REGISTRO NA ANVISA. PRAZO DE VALIDADE SUPERIOR A UM ANO NA DATA DA ENTREGA
10Unidade


25214/2022
12/08/2022 16:00:00
Dispensa de licitação
1199/2022 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: GRAMPO GALVANIZADO DE CERCAS RURAIS
Descrição: Compra de 10 pacotes de grampo galvanizado. Os grampos para cerca galvanizados Gerdau 1x9 são ideais para fixação de arames e alambrados em mourões de madeira. São galvanizados a fogo, o que concede uma excelente resistência contra a corrosão e a ação do tempo. Prefira sempre os grampos galvanizados, pois os pretos enferrujam facilmente no tempo. Os grampos de cerca servem tanto para arames lisos como para arames farpados. Em cada pacote ou saco de grampo de 1Kg da bitola 1x9" vem aproximadamente 194 grampos.
10Pacote
Produto/Serviço: PREGOS DE AÇO 18/30
Descrição: 01 PACOTE DE PREGOS DE AÇO 18X30 CM 1KG. Prego de Aço Temperado Niquelado 18x30 com Cabeça 1kg
1Pacote
Produto/Serviço: ARRUELAS LISA 3,38MMX055MM
Descrição: Arruela lisa Zincada d1 (Diâmetro Interno): 3,38 m/m d2 (Diâmetro Interno): 7 m/m Espessura (h): 0,55 m/m Material: Aço Carbono Acabamento
1Pacote
Produto/Serviço: JOELHO DE SOLDA 32
Descrição: COMPRA DE 10 UNID. DE JOELHO DE SOLDA 32. Joelho 32mm 90 Soldável em PVC Especialmente criada para projetos com instalações permanentes e embutidas, a linha soldável é perfeita para conduzir água fria, em obras residenciais, industriais ou comerciais. Vai construir, reformar ou fazer algum conserto? A linha soldável também é uma excelente solução para esses casos. Todos os produtos desta seção são feitos em PVC, suportando a pressão 7,5kgf/cm, produzidos na cor marrom para a linha soldável e produzidos na cor azul para a linha soldável com bucha de latão, ambas seguindo a determinação das normas brasileiras.
10Unidade
Produto/Serviço: BOCAL ADAPTADOR
Descrição: COMPRA DE 05 Bocal Adaptador E27 para Lâmpada E40 Porcelana Branco Fox Informações do Produto: Marca: Foxlux Material: Porcelana Cor: Branca Produto: Soquete Adaptador em Porcelana Rosca E-27 Para E-40 Potência: Até 500W Bocal Adaptador E27 para Lâmpada E40 Porcelana Branco Fox
10Unidade
Produto/Serviço: BROCA FERRO 1,5MM
Descrição: COMPRADE 05 A Broca Aço Rápido MTX é fabricada com aço rápido proporcionando maior durabilidade e resistência da ferramenta. Ela é ideal para metal, aço, chapas, e outros materiais ferrosos. Nas bordas das rachaduras espinais da broca, existem duas bandas cilíndricas estreitas. Especificações Técnicas: Diâmetro: 1,5mm; Comprimento da broca: 40mm; Ângulo de afiação da ponta: 118°; Fabricado: Aço rápido polido / HSS
5Unidade
Produto/Serviço: BROCA FERRO 2,00MM
Descrição: COMPRA DE 05 BROCAS DE FERRO 2,00MM- Material: Aço Rápido - Afiação em cruz - Alta performance - Revestimento Titânio: dura 5 vezes mais Especificações: - Diâmetro: 2 mm - Comprimento útil: 24 mm - Comprimento total: 49 mm - DIN: 338
5Unidade
Produto/Serviço: BROCA FERRO 3,00MM
Descrição: COMPRA DE 05 BROCAS DE FERRO 3,00MM Diâmetro (Ø): 3,0mm - Comprimento total (L): 61mm - Comprimento Canal (L1): 33mm Características - Estrutura em aço rápido. - Canais amplos e longos. - Corpo temperado com tratamento térmico. - Excelência na geometria de corte. - Resistência à fadiga. - Linha métrica conforme norma DIN 338 - Linha polegadas conforme norma ASME B94.11M - Vantagens - Agilidade e facilidade de manuseio. - Ângulo de ponta de 118° (reafiação). - Maior durabilidade. - Precisão. - Segurança.
5Unidade
Produto/Serviço: BROCA DE CONCRETO 3,00MM
Descrição: COMPRA DE 05 BROCAS DE CONCRETO Broca Widia para Concreto Irwin Standard 3 x 75 x 45 mm Para furação de paredes de concreto, pisos, azulejos e materiais de alvenaria em geral. Pastilha de Metal Duro de alta resistência. Canal com largura ampliada para rápida eliminação do pó.
5Unidade
Produto/Serviço: CAIXA DESCARGA SIMPLES
Descrição: COMPRA DE 03 CAIXAS DESCARGA SIMPLES Caixa De Descarga C-4 Externa Cipla + Engate 30cm + Brinde( Veda rosca)
3Unidade
Produto/Serviço: FITA ISOLANTE
Descrição: COMPRA DE 20 FITAS ISOLANTES TERMICAS Fita Isolante Uso Geral 18mm com 5 Metros Preta
20Unidade


25234/2022
12/08/2022 16:00:00
Dispensa de licitação
1209/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Protetor veda porta impermeável preto
Descrição: Protetor veda porta impermeável preto Melhor material para vedas, impermeável Material não têxtil: 100% filme de policloreto de vinila espuma: 100% polietileno (espuma de espaguete de piscina) Composição da embalagem: 01 veda porta impermeavel Medidas do produto Largura total: 110cm Altura total: 3,5 cm Profundidade total: 12 cm
3Unidade


25431/2022
12/08/2022 16:00:00
Dispensa de licitação
1210/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: DISCOS PARA ANTIBIOGRAMA - Colistina
Descrição: DISCOS PARA ANTIBIOGRAMA - Colistina
400Unidade
Produto/Serviço: DISCOS PARA ANTIBIOGRAMA - Sulfadoxina
Descrição: DISCOS PARA ANTIBIOGRAMA - Sulfadoxina
300Unidade
Produto/Serviço: DISCOS PARA ANTIBIOGRAMA - Tilosina
Descrição: DISCOS PARA ANTIBIOGRAMA - Tilosina
400Unidade


25458/2022
12/08/2022 16:00:00
Dispensa de licitação
1219/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: DOXICICLINA 50 MG COMPRIMIDO
Descrição: DOXICICLINA 50 MG COMPRIMIDO. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO RESPONSÁVEL TÉCNICO, LICENCIADO NO MAPA. REGISTRO NO MAPA. VALIDADE NO MÍNIMO DE 1 ANO NA DATA DE ENTREGA
192Comprimido


26058/2022
15/08/2022 16:00:00
Dispensa de licitação
1251/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: LAMINA SILANIZADA BRANCA LAPIDA CANTOS 45" 25X75MM - C/50
Descrição: LAMINA SILANIZADA BRANCA LAPIDA CANTOS 45" 25X75MM - Lâminas Silanizadas cortada, StarFrost, extremidades branca; Extremidade 20mm Medindo 26 x 76 x 1,0 (±) Extremidade cortada Vidro alcalino Prontas para uso Uma excelente opção para ulização em esfregaço de sangue, possui superficie hidrofílica, com uma área de marcação de 20mm, impressa com tinta especial, servindo de espaçador entre as peças afim de evitar arranhões ou aderência das lâminas quando empilhadas uma sobre as outras e resistente a diversos produtos químicos comuns utilizados em laboratórios caixas com 50 unidades
2Caixa


26384/2022
16/08/2022 16:00:00
Dispensa de licitação
1264/2022 Contratação de Outros Serviços
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: serviço de manutenção de equipamentos
Descrição: serviço de manutenção de equipamentos - Bomba de Infusão Laslo / BV Vet Defeito: Apresenta alarme contínuo de oclusão, mesmo após corrigidas as possíveis causas de oclusão. * Em anexo ilustrações do aparelho
1Unidade


26391/2022
12/08/2022 16:00:00
Dispensa de licitação
1270/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AMOXICILINA 14G/100ML +CLAVULANATO DE POTÁSSIO 3,5G/100ML FRASCO C/ 50 ML (MEDICAMENTO VETERINÁRIO)
Descrição: MEDICAMENTO VETERINÁRIO AMOXICILINA 14G/100ML +CLAVULANATO DE POTÁSSIO 3,5G/100ML FRASCO C/ 50 ML REGISTRO NO MAPA/MS. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA NA FARMÁCIA.
5Frasco


27246/2022
16/08/2022 16:00:00
Dispensa de licitação
1312/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: MESA CIRÚRGICA VETERINÁRIA ATENDE OS REQUISITOS SANITÁRIOS 100% AÇO INOX, REFORÇADA, DRENO: FURO CENTRAL PARA ESCOAMENTO COM BALDE INOX, SUPORTE PARA SORO.
Descrição: MESA CIRÚRGICA VETERINÁRIA ATENDE OS REQUISITOS SANITÁRIOS 100% AÇO INOX, REFORÇADA ideal para cachorros de pequeno, médio e grande porte Características Dimensão: 98 x 60 x 88 cm (C x L x A) Qualidade: Aço Inox Tampo Superior: Com vincos em chapa 0,80 mm Pés: Tubo 30x30 mm e sapata nylon Dreno: Furo central para escoamento com BALDE inox. Suporte para soro.
1Unidade


27788/2022
12/08/2022 16:00:00
Dispensa de licitação
1326/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CERA HEMOSTÁTICA PARA OSSO 2,5g
Descrição: CERA HEMOSTÁTICA PARA OSSO 2,5g. Mistura opaca e estéril de cera de abelha, parafina e diluentes, tendo como função, atuar como barreira mecânica na hemostasia local. Não possui atuação bioquímica e é minimamente absorvível. Indicada no controle de hemorragia a partir de superfície óssea. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
10Unidade
Produto/Serviço: COMPRESSA NEUROCIRÚRGICA DE FIBRA SINTÉTICA ESTÉRIL 13x13mm
Descrição: COMPRESSA NEUROCIRÚRGICA DE FIBRA SINTÉTICA ESTÉRIL 13x13mm para estruturas delicadas do sistema nervoso. Fabricadas em fibra de rayon de extrema pureza ou algodão prensado, por processo especial de entrelaçamento. Fixado no tecido, um fio de algodão impregnado com Sulfato de Bário que auxilia através das marcas radiopacas a identificação e o resgate das compressas quando utilizadas em cirurgias. Acondicionadas, presa em suporte de papel cartão, estéril, fechado com papel grau cirúrgico. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
5Unidade
Produto/Serviço: COMPRESSA COMPRESSA NEUROCIRÚRGICA DE FIBRA SINTÉTICA ESTÉRIL 19x19mm
Descrição: COMPRESSA NEUROCIRÚRGICA DE FIBRA SINTÉTICA ESTÉRIL 19x19mm para estruturas delicadas do sistema nervoso. Fabricadas em fibra de rayon de extrema pureza ou algodão prensado, por processo especial de entrelaçamento. Fixado no tecido, um fio de algodão impregnado com Sulfato de Bário que auxilia através das marcas radiopacas a identificação e o resgate das compressas quando utilizadas em cirurgias. Acondicionadas, presa em suporte de papel cartão, estéril, fechado com papel grau cirúrgico. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
5Unidade
Produto/Serviço: COMPRESSA NEUROCIRÚRGICA DE FIBRA SINTÉTICA ESTÉRIL 25x25mm
Descrição: COMPRESSA NEUROCIRÚRGICA DE FIBRA SINTÉTICA ESTÉRIL 25x25mm para estruturas delicadas do sistema nervoso. Fabricadas em fibra de rayon de extrema pureza ou algodão prensado, por processo especial de entrelaçamento. Fixado no tecido, um fio de algodão impregnado com Sulfato de Bário que auxilia através das marcas radiopacas a identificação e o resgate das compressas quando utilizadas em cirurgias. Acondicionadas, presa em suporte de papel cartão, estéril, fechado com papel grau cirúrgico. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
5Unidade
Produto/Serviço: COMPRESSA NEUROCIRÚRGICA DE FIBRA DE RAYON 1/2x1”
Descrição: COMPRESSA NEUROCIRÚRGICA DE FIBRA DE RAYON 1/2x1” Fabricadas em fibra de Rayon 100% absorção e proteção - 1/2x1” de extrema pureza, estéril. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
5Unidade


28082/2022
16/08/2022 16:00:00
Dispensa de licitação
1335/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Secador de Cabelo Maxis Travel 1200W
Descrição: Secador de Cabelo Maxis Travel 1200W de potência, 2 velocidades, Bivolt com Bocal direcionador.
1Unidade


28322/2022
12/08/2022 16:00:00
Dispensa de licitação
1342/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: bloco de nota fiscal
Descrição: COMPRA DE 2 BLOCOS DE NOTA FISCAL. sequência 2101 a 2248.
3Unidade


28647/2022
16/08/2022 18:00:00
Dispensa de licitação
1347/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Capa para encadernação
Descrição: Capa para encadernação e serviço de encadernação
12Unidade


28833/2022
12/08/2022 16:00:00
Dispensa de licitação
1357/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Placa de cultivo celular de baixa adesão 96 wells
Descrição: Placa de cultivo celular de baixa adesão 96 wells Superfície de fixação ultrabaixa com hidrogel de ligação covalente que minimiza a fixação celular, absorção de proteínas, ativação enzimática e ativação celular A superfície é não citotóxica, biologicamente inerte e não degradável Fundos redondos com volume total de 330 µL Volumes de trabalho recomendados de 75 a 200 µL Tampas irreversíveis com anéis de condensação para reduzir a contaminação Esterilizado por radiação gama e não pirogênico Códigos alfanuméricos individuais para identificação de poços Embalado individualmente
24Unidade


29100/2022
12/08/2022 16:00:00
Dispensa de licitação
1372/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: grampeador
Descrição: grampeador
1Unidade
Produto/Serviço: Porta canetas triplo Cristal
Descrição: Porta Canetas Triplo Cristal
3Unidade
Produto/Serviço: Marca texto amarelo 12 unidades
Descrição: Marca texto amarelo 12 unidades
1Caixa
Produto/Serviço: extrator de grampo
Descrição: extrator de grampo cromado.
4Unidade
Produto/Serviço: post-it colorido-Blocos de Notas Adesivas Post-It Tropical- 4 Blocos de 38 X 50 mm-50 folhas cada
Descrição: Blocos de Notas Adesivas Post-It Tropical- 4 Blocos de 38 X 50 mm-50 folhas cada.
5Unidade
Produto/Serviço: Fita Adesiva Larga 45mm X 10 mm
Descrição: Fita Adesiva Larga 45mm X 10 mm
2Unidade
Produto/Serviço: Tesoura
Descrição: Tesoura 180 mm, Comfort Grip, T416, Cinza,
1Unidade
Produto/Serviço: Estilete
Descrição: Estilete Multiuso Retrátil 18mm.
1Unidade
Produto/Serviço: almotolia plastica ambar 250ml -bico reto
Descrição: almotolia plastica ambar 250ml -bico reto
4Frasco


29101/2022
16/08/2022 16:00:00
Dispensa de licitação
1373/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Cortina, persianas horizontais, tipo rolô, metragem aproximada de cada peça de 1.20 X 1.20 m
Descrição: Confecção e Instalação de quatro persianas horizontais, tipo rolô, metragem aproximada de cada peça de 1.20 X 1.20 m.
4Unidade


29143/2022
15/08/2022 17:00:00
Dispensa de licitação
1374/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: kits
Descrição: kit Reparo FV158959 conforme anexo
1Kit


29148/2022
16/08/2022 16:00:00
Dispensa de licitação
1379/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Cabo de oxímetro de pulso - masimo compatível com monitor da Digicare LW9
Descrição: Cabo de oxímetro de pulso - masimo compatível com monitor da Digicare LW9
2Unidade


29150/2022
12/08/2022 16:00:00
Dispensa de licitação
1381/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: REMIFENTANILA 2MG - PÓ LIÓFILO FRASCO-AMPOLA
Descrição: REMIFENTANILA 2MG - PÓ LIÓFILO FRASCO-AMPOLA. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO
5Unidade


29162/2022
16/08/2022 17:00:00
Dispensa de licitação
1391/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ESPONJA HEMOSTÁTICA ABSORVÍVEL 80 x 125 mm (100 cm2 ) x 10 mm
Descrição: Esponja hemostática de gelatina absorvível estéril tamanho 100, aproximadamente 80 x 125 mm (100 cm2 ) x 10 mm. Composição de pele de porco purificada insolúvel em água, capaz de absorver até 45 vezes o seu peso em sangue. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
5Unidade
Produto/Serviço: ESPONJA HEMOSTÁTICA ABSORVÍVEL 7x5cmx1mm
Descrição: ESPONJA HEMOSTÁTICA ABSORVÍVEL 7x5cmx1mm. Esponja de gelatina suína estéril, insolúvel em água, maleável, destinada a uso hemostático, por aplicação em uma superfície sangrante. Indicado para poder ser usado com trombina ou soro fisiológico estéril. Aplica-se a produtos Film, Standard, Special, Anal e Dental. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
5Unidade
Produto/Serviço: ESPONJA HEMOSTÁTICA DE CELULOSE ABSORVÍVEL 50x75mm
Descrição: ESPONJA HEMOSTÁTICA DE CELULOSE ABSORVÍVEL 50x75mm. Produto estéril feito de celulose regenerada oxidada (ácido polioxian hidro glucurônico) capaz de formar massa gelatinosa em contato com o sangue . Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
5Unidade
Produto/Serviço: ESPONJA HEMOSTÁTICA DE GELATINA ABSORVÍVEL 10x10x10mm
Descrição: ESPONJA HEMOSTÁTICA DE GELATINA ABSORVÍVEL 10x10x10mm. Esponja de gelatina absorvível estéril com efeito hemostático adequada para o controle de sangramento, absorvendo 35 vezes o seu próprio peso no sangue e fluidos. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
5Unidade
Produto/Serviço: ESPONJA HEMOSTÁTICA DE GELATINA ABSORVÍVEL 30x20mm
Descrição: ESPONJA HEMOSTÁTICA DE GELATINA ABSORVÍVEL 30x20mm. Esponja de gelatina absorvível estéril com efeito hemostático adequada para o controle de sangramento, absorvendo 35 vezes o seu próprio peso no sangue e fluidos. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
5Unidade
Produto/Serviço: ESPONJA HEMOSTÁTICA DE GELATINA ABSORVÍVEL 80x50x10mm
Descrição: ESPONJA HEMOSTÁTICA DE GELATINA ABSORVÍVEL 80x50x10mm. Esponja de gelatina absorvível estéril com efeito hemostático adequada para o controle de sangramento, absorvendo 35 vezes o seu próprio peso no sangue e fluidos. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
5Unidade
Produto/Serviço: ESPONJA HEMOSTÁTICA DE COLÁGENO ABSORVÍVEL 30x50x2mm
Descrição: ESPONJA HEMOSTÁTICA DE COLÁGENO ABSORVÍVEL 30x50x2mm. Esponja de Matriz Orgânica de Colágeno Tipo I Polimerizado e Purificado Fibrilar e Hemostática. Produto com registro na ANVISA e validade mínima de um ano na data da entrega. Quantitativo para contrato anual e entrega de acordo com programação.
5Unidade
Produto/Serviço: CAPA PARA MICROSCÓPIO COM VISOR 95x215cm
Descrição: CAPA PARA MICROSCÓPIO COM VISOR 95x215cm
5Unidade


29397/2022
12/08/2022 16:00:00
Dispensa de licitação
1403/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: GELO RÍGIDO REUTILIZÁVEL EASYICE 500 ml - 12 unidades/1 caixa
Descrição: Gelo para preservar o sangue
1Caixa


29400/2022
12/08/2022 16:00:00
Dispensa de licitação
1406/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: COMPRESSA DE GAZE 13 FIOS - 10 X 10 CM - 10 unidades/1 pacote
Descrição: A gaze é utilizada para limpar a pele e conter o sangue
2Pacote


29401/2022
15/08/2022 17:00:00
Dispensa de licitação
1407/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SACO PARA LIXO INFECTANTE - 10 LITROS - PLASTIZEN - 100 unidades/1 caixa
Descrição: SACO PARA LIXO INFECTANTE
1Caixa


29402/2022
12/08/2022 16:00:00
Dispensa de licitação
1408/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CAIXA COLETORA (PAPELÃO) PERFURO CORTANTE - 5 Litros
Descrição: Caixa para descarte de material perfuro cortante
1Caixa


29499/2022
12/08/2022 16:00:00
Dispensa de licitação
1417/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Phenol
Descrição: Phenol Tamponado BioReagent, Equilibrated with 10 mM Tris HCl, pH 8.0, 1 mM EDTA, para molecular biology Frasco 400mL
1Frasco


29500/2022
12/08/2022 16:00:00
Dispensa de licitação
1418/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AGULHA PERIDURAL TUOHY 20G X 3,5 UN
Descrição: AGULHA PERIDURAL TUOHY 20G X 3,5 UN. Agulha técnica Descartável para anestesia regional com ponta tipo tuohy (curva) apirogênica e estéril. Embalagem unitária contendo número de lote, data fabricação e validade. Registro na Anvisa/MS VALIDADE DE NO MÍNIMO DE 1 ANO NA DATA DE ENTREGA
30Unidade


29951/2022
15/08/2022 16:00:00
Dispensa de licitação
1441/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ovos embrionados de aves livres de patógenos específicos (SPF)
Descrição: Seriam ovos embrionados + frete aéreo.
180Unidade


30179/2022
12/08/2022 16:00:00
Dispensa de licitação
1444/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: termostato
Descrição: Modelo: KSD temperatura 145ºC
1Unidade


30412/2022
12/08/2022 18:00:00
Dispensa de licitação
1446/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: lâmpada
Descrição: lâmpadalâmpada Tipo:Incandescente Potência: 15 W Tensão elétrica: 127 V Soquete: E14
1Unidade


30470/2022
16/08/2022 18:00:00
Dispensa de licitação
1449/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Handicap Equinos
Descrição: Indicação: Recomendado para eqüinos no controle das verminoses causadas por: Grandes estrôngilus: Strongylus vulgaris (adultos e estágio arterial) S. edentatus (adultos e larvas encistadas) S. equinus (adultos) Triodontophorus spp. (Adultos). Pequenos estrôngilus: Cyathostomun spp. (adultos e larvas de 4º estágio) Cylicocyclus spp. (adultos e larvas de 4º estágio) Cylicostephanus spp. (adultos e larvas de 4º estágio) Cylicodontophorus spp. (adultos e larvas de 4º estágio) Cyalocephalus spp. (adultos e formas imaturas). Outros nematódeos: Oxyuris equi (adultos e larvas de 3º e 4º estágios) Parascaris equorum (adultos e larvas de 3º e 4º estágios) Strongyloides westeri (adultos) Trichostrongylus axei (adultos) Draschia spp. (larvas de 3º estágio) Habronema muscae (adultos) Onchocerca spp. (microfilárias) Dictyocaulus arnfield (adultos e larvas 4º estágio). Cestódeos: Anaplocephala perfoliata A. magna Paranoplocephala mamillana. Larvas: Gasterophilus spp. (estágio oral e gástrico). HANDICAP EQÜINOS é indicado ainda no controle das lesões cutâneas causadas por larvas de Habronema spp. Draschia spp. e Onchocerca spp. (microfilárias cutâneas). Formula: Cada 100g contém: Ivermectina......................................................... 12g Praziquantel...................................................... 150g Ranitidina*........................................................ 440g Excipiente q.s.p.................................................. 100g *equivalente a 498g de Cloridrato de ranitidina Apresentação: Seringas plásticas graduadas com 10g - tratamento para 600Kg de peso vivo.
11Unidade


30474/2022
11/08/2022 16:00:00
Dispensa de licitação
1453/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FARINHA DE CARNE E OSSOS
Descrição: Farinha de carne e ossos ensacada. 4500 kg. sacos de 50 kg.
4500Quilograma


30476/2022
12/08/2022 17:00:00
Dispensa de licitação
1455/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: feno de alfafa tipo A
Descrição: Compra de 2.000kg feno Alfafa tipo A para setor de Fabrica
2000Quilograma


30608/2022
12/08/2022 16:00:00
Dispensa de licitação
1463/2022 Equipamentos/Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Windows 10 PRO 64 Bits -
Descrição: Windows 10 PRO 64 Bits - Licença OEM Perpétua Software: Windows 10 PRO 64 Bits - Licença OEM Perpétua
1Unidade


30708/2022
12/08/2022 16:00:00
Dispensa de licitação
1466/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Ração para equinos
Descrição: Ração Equimix Tradicional ou Equimix Esporte. Saco 40kg Proteína Bruta (mín.) 120g (12%)
24Saco
Produto/Serviço: Feno Tifton
Descrição: Fardos com peso médio de 15 a 20kg.
13000Quilograma


30846/2022
12/08/2022 16:00:00
Dispensa de licitação
1467/2022 Equipamentos/Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: notebook
Descrição: notebook Notebook Samsung Book Intel Core I3-1115G4, 4GB RAM, 1TB HD, 15.6´ 1920 x1080 Full HD, Windows 10 Home, Prata - NP550XDA-KT1BR
1Caixa


30847/2022
15/08/2022 16:00:00
Dispensa de licitação
1468/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: PANOTICO CONJUNTO P/COLORACAO 3X500ML.
Descrição: PANOTICO CONJUNTO P/COLORACAO 3X500ML.
1Unidade
Produto/Serviço: ReliaPrep FFPE gDNA Miniprep System (100 REAÇÕES).
Descrição: ReliaPrep FFPE gDNA Miniprep System (100 REAÇÕES).
1Unidade
Produto/Serviço: TAQ DNA POLIMERASE (500).
Descrição: TAQ DNA POLIMERASE (500).
1Unidade


30972/2022
15/08/2022 16:00:00
Dispensa de licitação
1471/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Fechadura eletrônica digital
Descrição: Fechadura digital com gateway, padrão Pado Fde-300W ou similar, resistente à água, leitura por biometria, com as seguintes características: Alimentação: 4 Pilhas AA Alimentação de emergência: Porta micro-USB Alarme Anti-arrombamento: Sim Guia de voz em português: Sim Capacidade máxima de impressões digitais: 200 Capacidade máxima de senhas numéricas: 150 Capacidade máxima de cartões: 200 Tipo de instalação: De embutir Cor: Preto Método de Abertura: Senha, Biometria, Bluetooth, Cartão, aplicativo e Chave manual
1Unidade


30973/2022
12/08/2022 16:00:00
Dispensa de licitação
1472/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ELETRIFICADOR FOGGIATTO FG70 8 JOULES 127V/220V
Descrição: ELETRIFICADOR FOGGIATTO FG70 8 JOULES 127V/220V
1Unidade


30975/2022
15/08/2022 16:00:00
Dispensa de licitação
1474/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: DRENO DE PENROSE Nº 1
Descrição: DRENO DE PENROSE Nº 1 - dreno de látex, biocompatível de alta resistência e flexibilidade, embalados individualmente em papel grau cirúrgico / PET-PE e esterilizados em óxido de etileno. Dimensões: espessura mín. 0,15mm, comprimento mín. 300mm, diâmetro médio 6mm. Embalagem individual contendo dados do produto, data de fabricação, prazo de validade, responsável técnico e registro na ANVISA. Validade de no mínimo 1 ano no momento da entrega na farmácia.
10Unidade
Produto/Serviço: DRENO DE PENROSE Nº 2
Descrição: DRENO DE PENROSE Nº 2 - dreno de látex, biocompatível de alta resistência e flexibilidade, embalados individualmente em papel grau cirúrgico / PET-PE e esterilizados em óxido de etileno. Dimensões: espessura mín. 0,15mm, comprimento mín. 300mm, diâmetro médio 12mm. Embalagem individual contendo dados do produto, data de fabricação, prazo de validade, responsável técnico e registro na ANVISA. Validade de no mínimo 1 ano no momento da entrega na farmácia.
30Unidade
Produto/Serviço: DRENO DE PENROSE Nº 3
Descrição: DRENO DE PENROSE Nº 3 - dreno de látex, biocompatível de alta resistência e flexibilidade, embalados individualmente em papel grau cirúrgico / PET-PE e esterilizados em óxido de etileno. Dimensões: espessura mín. 0,15mm, comprimento mín. 300mm, diâmetro médio 19mm. Embalagem individual contendo dados do produto, data de fabricação, prazo de validade, responsável técnico e registro na ANVISA. Validade de no mínimo 1 ano no momento da entrega na farmácia.
30Unidade


30983/2022
12/08/2022 16:00:00
Dispensa de licitação
1482/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Luvas tamanho P
Descrição: Caixa de luvas de procedimento latex sem pó caixa com 50 pares tamanho P
30Caixa


31076/2022
12/08/2022 17:00:00
Dispensa de licitação
1488/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Kit para extração de ácido nucleico
Descrição: Maxwell® 16 Tissue DNA Purification Kit - código AS1030
1Caixa


31077/2022
15/08/2022 16:00:00
Dispensa de licitação
1489/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Discos para antibiograma
Descrição: Eritromicina 15 microgramas - caixa com 5 unidades contendo 50 discos cada
1Caixa
Produto/Serviço: Disco de antibiograma
Descrição: Amoxicilina 10 microgramas - caixa com 5 unidades contendo 50 discos cada
1Caixa
Produto/Serviço: Discos para antibiograma
Descrição: Norfloxacina 10 microgramas - caixa com 5 unidades contendo 50 discos cada
1Caixa
Produto/Serviço: Discos para antibiograma
Descrição: Neomicina 10 microgramas - caixa com 5 unidades contendo 50 discos cada
1Caixa
Produto/Serviço: Discos para antibiograma
Descrição: Florfenicol 30 microgramas - caixa com 5 unidades contendo 50 discos cada
1Caixa
Produto/Serviço: Disco para antibiograma
Descrição: Sulfametoxazol-trimetoprim 25 microgramas - caixa com 5 unidades contendo 50 discos cada
1Caixa


31504/2022
16/08/2022 16:00:00
Dispensa de licitação
1491/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SuperScript™ III Platinum™ One-Step qRT-PCR Kit. Catálogo número 11732088 Thermo Fisher Scientific
Descrição: A técnica foi padronizada com essa marca e especificação de reagentes. Neste contexto, a marca e número de catálogo precisam ser respeitados.
2Kit


31591/2022
12/08/2022 16:00:00
Dispensa de licitação
1492/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SONDA DE FOLEY 10FR - sonda 100% silicone médico
Descrição: SONDA DE FOLEY 10FR - sonda 100% silicone médico transparente, radiopaca, tamanho 10FR, com balão em sua extremidade, ponta fechada ou Tiemann, em silicone, graduada, biocompatível, flexível e confortável para o paciente, não irritante que possibilita a permanência no corpo do animal por longos períodos sem necessidade de trocas. Com fio guia radiopaco e tampa protetora. Validade mínima de um ano na data da entrega.
5Unidade
Produto/Serviço: SONDA DE FOLEY 6FR - sonda 100% silicone médico
Descrição: SONDA DE FOLEY 4FR - sonda 100% silicone médico transparente, radiopaca, tamanho 4FR, com balão em sua extremidade, ponta fechada ou Tiemann, em silicone, graduada, biocompatível, flexível e confortável para o paciente, não irritante que possibilita a permanência no corpo do animal por longos períodos sem necessidade de trocas. Com fio guia radiopaco e tampa protetora. Validade mínima de um ano na data da entrega.
4Unidade
Produto/Serviço: SONDA DE FOLEY 12FR - sonda 100% silicone médico
Descrição: SONDA DE FOLEY 12FR - sonda 100% silicone médico transparente, radiopaca, tamanho 12FR, com balão em sua extremidade, ponta fechada ou Tiemann, em silicone, graduada, biocompatível, flexível e confortável para o paciente, não irritante que possibilita a permanência no corpo do animal por longos períodos sem necessidade de trocas. Com fio guia radiopaco e tampa protetora. Validade mínima de um ano na data da entrega.
10Pacote


31592/2022
12/08/2022 16:00:00
Dispensa de licitação
1493/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: kit casqueamento/ferrageamento para cavalo
Descrição: kit casqueamento/ferrageamento para cavalo
1Kit
Produto/Serviço: tripé de apoio para procedimentos básicos de casqueamento/ferrageamento
Descrição: tripé de apoio para procedimentos básicos de casqueamento/ferrageamento
1Unidade
Produto/Serviço: pinça de casco mini inox
Descrição: pinça de casco mini (inox), essencial para que o Médico Veterinário consiga diagnosticar possíveis problemas ou afecções presentes nesse animal, exercendo pressão em dois pontos, com a intenção de causar reações no animal que entreguem dores e desconfortos.
1Unidade


31593/2022
12/08/2022 17:00:00
Dispensa de licitação
1494/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Feno A
Descrição: Feno Tipo A - Tifton-85 - Cada Fardo de Feno aproximadamente de 35 kg - Atenção para a qualidade do Feno - Programar entrega com a Administração do HV UFMG. * Entrega fracionada de cerca de 50 fardos a cada 7 dias.
300Fardo


31651/2022
12/08/2022 16:00:00
Dispensa de licitação
1499/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Sangue de carneiro desfrinido
Descrição: Sangue desfibrinado de carneiro - frasco 50 mL
12Unidade


31654/2022
12/08/2022 14:00:00
Dispensa de licitação
1500/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: teclado simples
Descrição: teclado simples
1Unidade
Produto/Serviço: mouse simples
Descrição: mouse simples
1Unidade
Produto/Serviço: calculadora simples
Descrição: calculadora simples
1Unidade
Produto/Serviço: pilha alcalina ELGIN ENERGY - AA - blister c/02 pilhas
Descrição: pilha alcalina ELGIN ENERGY - AA - blister c/02 pilhas
2Unidade
Produto/Serviço: estabilizador SMS
Descrição: estabilizador SMS
1Unidade


31655/2022
15/08/2022 16:00:00
Dispensa de licitação
1501/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Maxwell
Descrição: Maxwell® 16 Tissue DNA Purification Kit - AS1030
10Kit


31686/2022
15/08/2022 16:00:00
Dispensa de licitação
1503/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Máscara semi-facial com filtro químico (vapores orgânicos e inorgânicos)
Descrição: Materiais para uso em laboratorio em analises quimicas.
3Unidade
Produto/Serviço: Luva para procedimento nitrílica não estéril sem pó - caixa c/ 100 unidades - Tam: P
Descrição: Material de Consumo
3Caixa
Produto/Serviço: Luva para procedimento nitrílica não estéril sem pó - caixa c/ 100 unidades - Tam: M
Descrição: Material de Consumo
3Caixa
Produto/Serviço: Resina catônica + capsula para deionizador Quimis modelo - Q380S
Descrição: Material de Consumo
1Unidade
Produto/Serviço: Silicone graxa ( para uso em dessecadores)- 100 gramas
Descrição: Material de Consumo
1Frasco
Produto/Serviço: Resina aniônica + cápsula para deionizador Quimis modelo - Q380S
Descrição: Material de Consumo
1Unidade


32208/2022
16/08/2022 11:00:00
Dispensa de licitação
1511/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: papel kraft
Descrição: papel kraft liso e 80g, rolo 60 cm x 150m
4Rolo


32222/2022
16/08/2022 16:00:00
Dispensa de licitação
1513/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CATETER INTRAVENOSO INSYTE 14GA X 1.75''
Descrição: CATETER INTRAVENOSO INSYTE 14GA X 1.75" cateter intravenoso radiopaco estéril, 14GA X 1.75´2,1 x 45mm, 330mL/min, PERIFÉRICO, SEM DISPOSITIVO DE RECOLHIMENTO, para terapia intravenosa periférica. Esterilizado por óxido de etileno. Embalagem individual conforme legislação vigente, registro no M.S. ANVISA, contendo especificação do produto, fabricante, número de lote, data de fabricação, prazo de validade, SAC padronização de cores de acordo com NBR ISSO10555-5. OBS: NÃO COTAR ANGIOCAT, SOMENTE PERIFÉRICO
200Unidade


32226/2022
15/08/2022 16:00:00
Dispensa de licitação
1515/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SONDA URETRAL PARA GATOS
Descrição: SONDA URETRAL PARA GATOS -1.0 MM DE ESPESSURA x 130 MM DE COMPRIMENTO. SEMI-FLEXÍVEL. EXTREMIDADE ABERTA PARA NÃO LESIVO DA MUCOSA. COM ACOPLADOR DE SERINGA.
30Unidade


32233/2022
12/08/2022 16:00:00
Dispensa de licitação
1521/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Ração Felino
Descrição: Ração para Gatos Adulto - Premium - Cada Saco com 10Kg
10Saco


33024/2022
15/08/2022 16:00:00
Dispensa de licitação
1530/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Sorotipagem de isolados de Salmonella sp.
Descrição: Sorotipagem de isolados de Salmonella sp.
10Unidade


33029/2022
16/08/2022 16:00:00
Dispensa de licitação
1532/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ISOFLURANO ISOFLURANO 1 MG/ML - C/ 100 ML - SOLUÇÃO INJETÁVEL
Descrição: ISOFLURANO 1 MG/ML - C/ 100 ML - SOLUÇÃO INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA
25Frasco


33032/2022
16/08/2022 15:00:00
Dispensa de licitação
1535/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SORO RINGER LACTATO SOLUÇÃO INJETÁVEL FRASCO C/ 1000ML
Descrição: SORO RINGER LACTATO SOLUÇÃO INJETÁVEL ESTÉRIL E APIROGÊNICA ACONDICIONADA EM FRASCO CONTENDO 1000ML. EMBALAGEM UNITÁRIA CONTENDO NÚMERO DO LOTE; DATA DE FABRICAÇÃO E DATA DE VALIDADE. REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 01 ANO NO MOMENTO DA ENTREGA. PARCELAR BOLETO E ENTREGA EM 2X
800Frasco


33049/2022
16/08/2022 16:00:00
Dispensa de licitação
1541/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FILGRASTIM 300MCG/ML, FRASCO AMPOLA C/ 1ML
Descrição: FILGRASTIM 300MCG/ML, FRASCO AMPOLA C/ 1ML. IDENTIFICAÇÃO DO LOTE, DATA DE VALIDADE, COMPOSIÇÃO. REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER NO MÍNIMO DE 1 ANO NA DATA DE ENTREGA NA INSTITUIÇÃO
5Unidade


33050/2022
15/08/2022 16:00:00
Dispensa de licitação
1542/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ração para cães
Descrição: Ração para Cães adultos de grande porte. sacos de 20 ou 25 kg. Ração PREMIUM. * Alimentação recomendada para pacientes hospitalizados.
5Saco
Produto/Serviço: Ração para cães
Descrição: Ração para Cães adultos de pequeno porte. sacos de 10,1 ou 15 kg. Alimentação recomendada para pacientes hospitalizados.
2Saco
Produto/Serviço: Ração para cães
Descrição: Ração para Cães adultos de médio porte. sacos de 10,1 ou 15 kg. Alimentação recomendada para pacientes hospitalizados.
3Saco


33052/2022
16/08/2022 18:00:00
Dispensa de licitação
1544/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FIO P/ SUTURA ÁCIDO POLIGLICÓLICO 6-0
Descrição: FIO P/ SUTURA ÁCIDO POLIGLICÓLICO 6-0 AG 1/2 CIL Descrição: Fio de sutura de ácido poliglicólico, tamanho 6-0 Comprimento do fio 45 cm, formato da agulha 1/2 círculo. Validade de no mínimo 75% do prazo total de validade no momento de entrega na farmácia.
12Unidade


33053/2022
15/08/2022 16:00:00
Dispensa de licitação
1545/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FIO P/ SUTURA CAPROFYL 2-0
Descrição: Fio de sutura de poliglecaprone 25, tamanho 2-0, comprimento do fio 90 cm; formato da agulha 1/2 círculo, comprimento da agulha 36 mm. (CAPROFYL). Caixa com 24 unidades
240Unidade


33055/2022
15/08/2022 15:00:00
Dispensa de licitação
1547/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Cadeira De Escritorio Com Base Cromada Prizi - 9055
Descrição: Cadeira de Escritório com Base Cromada Prizi - 9055A cadeira de escritório conta com base cromada moderna e muito confortável! Modelo com regulador de altura, revertido com tecido mesh e rodízios em nylon
2Unidade


33056/2022
13/08/2022 16:00:00
Dispensa de licitação
1548/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Rolo para esterilização 50 mm X 100 m
Descrição: Material de Consumo
3Bobina
Produto/Serviço: Rolo para esterilização 30 cm x 100m
Descrição: Material de Consumo
1Bobina


33058/2022
15/08/2022 14:00:00
Dispensa de licitação
1550/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: tonner
Descrição: Toner Ricoh - preto Print Cartridge Black MP C406 EDP code: 842091
2Unidade


33061/2022
15/08/2022 15:00:00
Dispensa de licitação
1553/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SACO PLÁSTICO - de baixa densidade medindo 30 cm de largura x 25 cm de altura x 0,2 mm de espessura, rolo com 100 sacos
Descrição: Descrição: SACO PLÁSTICO - de baixa densidade medindo 30 cm de largura x 25 cm de altura x 0,2 mm de espessura, rolo com 100 sacos
10Rolo
Produto/Serviço: SACO PLÁSTICO - de baixa densidade medindo 40 cm de largura x 60 cm de altura x 0,2 mm de espessura, rolo com 100 sacos
Descrição: Descrição: SACO PLÁSTICO - de baixa densidade medindo 40 cm de largura x 60 cm de altura x 0,2 mm de espessura. Rolo com 100 sacos
15Rolo


33077/2022
16/08/2022 16:00:00
Dispensa de licitação
1555/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Cartucho de Gases Sanguíneos - Tipo CG8. CAIXA C/ 25 UNIDADES
Descrição: Cartucho de Gases Sanguíneos - Tipo Cg8 - (Glicose, Na, K, iCa, Hct, Hb, pH, PCO2, PO2, TCO2, HCO3, BEecf, sO2).CAIXA COM 25 UNIDADES. VALIDADE SUPERIOR A 6 MESES
2Caixa


33078/2022
15/08/2022 16:00:00
Dispensa de licitação
1556/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SWAB HASTE EM PLÁSTICO COM MEIO STUART - EMBALAGEM INDIVIDUAL
Descrição: SWAB HASTE EM PLÁSTICO COM MEIO STUART. ESTÉRIL, EMBALADO INDIVIDUALMENTE. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA
100Unidade


33080/2022
13/08/2022 16:00:00
Dispensa de licitação
1557/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: COLETOR UNIVERSAL ESTÉRIL GRADUADO COM CAPACIDADE PARA 70 ML
Descrição: Coletor universal estéril graduado com capacidade para 70 ml, tampa vermelha c/rosca de 9 mm de altura, coletor com 52 mm de altura e 52 mm de diâmetro confeccionado em polipropileno( translucido),s/ pá. embalagem individual contendo os dados impressos de identificação, lote, data de fabricação e validade Especificação: COLETOR UNIV 80ML T. VERM 9MM S/PA ESTERIL EMB. IN Frascos com abertura larga, destinados ao armazenamento, preservação e transporte de amostras biológicas para o processamento e análise em laboratórios de análises clínicas. Características: - Fabricado em polipropileno transparente; - Tampa fabricada em polietileno de alta densidade; - Tampa vermelha; - Sistema de vedação tipo rosca; - Embalado individualmente; - Sem pá; - Graduado; - Estéril por Radiação Ionizante (E-beam); - Volume: 80 mL. - Diâmetro externo inferior 45,04 mm - Diâmetro externo superior 50,93 mm - Altura 57,13 mm - Diâmetro da tampa 53,29.
500Unidade


33081/2022
12/08/2022 16:00:00
Dispensa de licitação
1558/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FLUORESCEÍNA, SÓDICA 1% COLÍRIO - FRASCO C/ 3 ML
Descrição: FLUORESCEÍNA, SÓDICA 1% COLÍRIO - FRASCO C/ 3 ML. PRAZO DE VALIDADE SUPERIOR A UM ANO NO MOMENTO DA ENTREGA. MEDICAMENTO COM REGISTRO NA ANVISA
8Frasco


33083/2022
15/08/2022 16:00:00
Dispensa de licitação
1559/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: MORFINA, SULFATO 1 MG/ML - SOLUÇÃO INJETÁVEL AMPOLA C/2 ML.
Descrição: MORFINA, SULFATO 1 MG/ML - SOLUÇÃO INJETÁVEL AMPOLA C/2 ML. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO.
50Ampola


33084/2022
15/08/2022 16:00:00
Dispensa de licitação
1560/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AGULHA P/ RAQUI (SPINAL) 20G 3 1/2 DESCARTÁVEL
Descrição: AGULHA P/ RAQUI (SPINAL) 20G 3 1/2 DESCARTÁVEL
20Unidade


33085/2022
13/08/2022 16:00:00
Dispensa de licitação
1561/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CARVÃO ATIVADO - PÓ SACHÊ C/ 8 GRAMAS
Descrição: CARVÃO ATIVADO - PÓ SACHÊ C/ 8 GRAMAS- SACHÊ C/ 8 GRAMAS. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO RESPONSÁVEL TÉCNICO, LICENCIADO NO MAPA. REGISTRO NO MAPA. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA
30Frasco


33088/2022
13/08/2022 16:00:00
Dispensa de licitação
1563/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: PATÊ AD LATA
Descrição: Pate A/D lata. Composição: Água, Míudos de Aves, Fígado Suíno, Carne Mecanicamente Separada de Frango, Farinha de Milho, Farinha de Torresmo, Óleo de Peixe Refinado, Carbonato de Cálcio, Hidrolisado de Fígado de Frango, Tripolifosfato de Sódio, Cloreto de Potássio, Fosfato Bicálcico, Goma Guar, Vitaminas (Vitamina B12, Ácido Ascórbico Polifosfato (fonte de vitamina C), D3, E, Ácido Fólico (B9), Biotina (B7), Cloreto de Colina, Mononitrato de Tiamina (B1), Niacina (B3), Pantotenato de Cálcio (B5), Cloridrato de Piridoxina (B6), Riboflavina (B2)), Betacaroteno, Minerais (Sulfato Ferroso, Óxido de Zinco, Sulfato de Cobre, Sulfato de Manganês, Iodato de Cálcio), Citrato de Potássio, Gema de Ovo, Taurina, DL-Metionina, Cisteína, Glicina, Ácido Cítrico, Óxido de Magnésio, Dextrose.
300Lata


33089/2022
12/08/2022 16:00:00
Dispensa de licitação
1564/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AMOXICILINA 1000MG + ACIDO CLAVULÂNICO 200MG - PÓ INJETÁVEL FRC
Descrição: AMOXICILINA 1000MG + ÁCIDO CLAVULÂNICO 200MG - PÓ INJETÁVEL ) Validade de no mínimo 1 ano no momento da entrega na farmácia. Medicamento com registro na ANVISA
300Frasco


33092/2022
15/08/2022 16:00:00
Dispensa de licitação
1566/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CATÉTER VENOSO CENTRAL MONOLUMEN VENOSELD 5FR - 20 CM (16G)
Descrição: CATÉTER VENOSO CENTRAL MONOLUMEN VENOSELD 5FR - 15 CM, , em poliuretano, com introdutor de seldinger, fio guia metálico resistente a dobras, ponta flexível - traumática, radiopaco, marcas de profundidade, dupla asa de fixação. embalagem unitária contendo número do lote; data de fabricação e data de validade; registro na ANVISA. Validade de no mínimo 1 ano após entrega
5Unidade


33093/2022
12/08/2022 16:00:00
Dispensa de licitação
1567/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: HIDROCORTISONA, SUCCINATO SÓDICO 500 MG PÓ LIOFILIZADO
Descrição: HIDROCORTISONA - 500 MG PÓ LIOFILIZADO REGISTRO NA ANVISA. DATA DE VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA. QUANTIDADE: 100 FRASCOS - AMPOLA
50Frasco


33096/2022
15/08/2022 19:00:00
Dispensa de licitação
1568/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: PAPEL TOALHA 23CM X23CM BRANCO NATURAL. FARDO COM 5 PACOTES
Descrição: TOALHA DE PAPEL INTERFOLHADA 23X23cm- PAPEL TOALHA NATURAL 23CM X 23CM INTERFOLHADA - 2 DOBRAS, BRANCO EM 100% CELULOSE, FARDO COM 5 PACOTES, TOTAL DE 1250 FOLHAS POR PACOTE.
400Pacote


33177/2022
15/08/2022 16:00:00
Dispensa de licitação
1569/2022 Hospedagem
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Hospedagem
Descrição: Hospedagem, sendo 3 quartos duplos e 3 solteiros.
6Unidade


33178/2022
13/08/2022 16:00:00
Dispensa de licitação
1570/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: prancheta de acrílico
Descrição: Prancheta 1/2 Oficio, Cristal Especificações: Base em Poliestireno 2 Réguas na base 1 transferidor na base Medida Produto Acabado 255x160x40 mm
8Unidade
Produto/Serviço: Garrafa Térmica Inox 500ml Com Click Top
Descrição: Garrafa Térmica Inox 500ml Para Água Café Chá Com Click Top, Totalmente em aço inox inquebrável, por dentro e por fora (parede dupla); Resistente a quedas e choques térmicos; Tampa especial com sistema seguro de isolamento. Dimensões: 8 x 25 x 8 cm; Material: Aço inox; Cor: Metálico
10Unidade
Produto/Serviço: Caneta esferográfica ponta grossa
Descrição: Caneta esferográfica ponta grossa. caixa com no mínimo 20 unidades. cor preta ou azul.
1Caixa


33374/2022
12/08/2022 16:00:00
Dispensa de licitação
1573/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SACO PLÁSTICO PARA SELADORA - 30 CM LARGURA x 25 CM DE ALTURA x 0,15 CM- PACOTE COM 100 UNIDADES
Descrição: Descrição: SACO PLÁSTICO PARA SELADORA - 30 CM LARGURA x 25 CM DE ALTURA x 0,15 CM - PACOTE COM 100 UNIDADES
30Pacote


33375/2022
13/08/2022 16:00:00
Dispensa de licitação
1574/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: MASCARA CIRÚRGICA DESCARTÁVEL COM ELASTICO - CAIXA COM 50UN
Descrição: MASCARA CIRÚRGICA DESCARTÁVEL - com 03 camadas; de não tecido; complemento: confeccionada com 02 camadas de não-tecido, uma camada de filtro bacteriano, modelo retangular, com pregas longitudinais, dispositivo para ajuste nasal, com elastico lateral, inodora, atóxica e hipoalergênica, gramatura total 40grs/m². Embalagem com 50 unidades.
100Caixa


33376/2022
13/08/2022 16:00:00
Dispensa de licitação
1575/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Caneta- Código ACCN0032 - PBC 24-3m
Descrição: Caneta Porta Eletrodos autoclavável e reutilizável com cabo de silicone de 03 metros; Código ACCN0032 - PBC 24-3mm Que seja compatível: Observação: Equipamento: Bisturi elétrico NanoMax. Código produto: EQBI0010.
5Unidade
Produto/Serviço: Pinça - Código ACPI0001
Descrição: Pinça Hemastática Bipolar Baioneta Autoclavável. Comprimento da Pinça - 160 mm. Comprimento da Ponta - 1 mm compatível com observação: Código ACPI0001 Equipamento: Bisturi elétrico NanoMax. Código produto: EQBI0010.
1Unidade
Produto/Serviço: Eletrodo - Código Acelo 136
Descrição: Eletrdo Eletrocirurgico Faca X 45º Comprimento da Haste - 50 mm Diâmetro da Haste-2,4 mm x 45º /Código Acelo 136 -Compatível com Bisturi Elétrico NonoMax. Código: EQBI0010.
1Unidade


33378/2022
31/08/2022 16:00:00
Importação
10/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FOSS PM.Kit, BSCFC N.VC
Descrição: código 01055029 - FOSS PM.Kit, BSCFC N.VC
2Peça


33379/2022
13/08/2022 16:00:00
Dispensa de licitação
1577/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SONDA URETRAL FLEXÍVEL DE ESPERA (CATETER) - tamanho 3.5 Fr/Ch
Descrição: Na cor vermelha, entrada em funil, dois olhos, ponta arredondada fechada. Com a temperatura do corpo torna-se mais macia, elástica, flexível. Livre de látex. Medida: 1,2mm x 41cm. Tamanho: 3.5 Fr/Ch 1.7mm x 16" (41cm)
20Unidade


33380/2022
13/08/2022 16:00:00
Dispensa de licitação
1578/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Tetraidrofurano P.A.
Descrição: 6 Litros de Tetraidrofurano (THF) P.A.
6Litro


33434/2022
13/08/2022 16:00:00
Dispensa de licitação
1579/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Discos para antibiograma
Descrição: Enrofloxacina 5 microgramas - caixa com 5 unidades contendo 50 discos cada
1Caixa
Produto/Serviço: Florfenicol
Descrição: Florfenicol (padrão analítico, pureza 100%) - frasco com 500 miligramas.
1Frasco


33471/2022
13/08/2022 16:00:00
Dispensa de licitação
1580/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: POP-7-polymer
Descrição: POP-7 Polymer, ABI -500, 960 amostras
1Tonelada


33473/2022
13/08/2022 16:00:00
Dispensa de licitação
1582/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Ponteiras diversas com filtro
Descrição: 1 caixa ponteiras 10ul, 1 caixa ponteiras 20 ul, 2 caixas ponteiras 100ul, 2 caixas ponteiras 200ul, e 2 caixas ponteiras 1250ul.
8Caixa


33597/2022
12/08/2022 16:00:00
Dispensa de licitação
1584/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Bebedouro para Coelhos
Descrição: Bebedouro automático para Coelhos, contendo pelo menos 250ml, mas podendo ser maior. Bico em inox.
30Unidade


33598/2022
13/08/2022 16:00:00
Dispensa de licitação
1585/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Primer Forward P1570 PCV2
Descrição: Primer Forward Identificação: P1570 PCV2 (forward primer) Sequência: 5'-TGGCCCGCAGTATTCTGATT-3' Purificação: Dessalinização Escala: 25nmol
1Unidade
Produto/Serviço: P1642 (reverse primer)
Descrição: Identificação: P1642 (reverse primer) Sequência: 5'-CAGCTGGGACAGCAGTTGAG-3' Purificação: Dessalinização Escala: 25nmol
1Unidade
Produto/Serviço: Probe P1591
Descrição: Identificação: P1591 (TaqMan probe) Sequência: 5'-6FAM-CCAGCAATCAGACCCCGTTGGAATG-TAMRA-3' Purificação: HPLC Escala: 25nmol
1Unidade


33599/2022
13/08/2022 16:00:00
Dispensa de licitação
1586/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Primer Forward UNIV1
Descrição: Identificação: UNIV1 Forward Sequência 5'-3': GACCAATGATATGAAAAACCATCGTTGT Purificação: Dessalinização
1Unidade
Produto/Serviço: Primer UNIV 3
Descrição: Identificação: UNIV3 Forward Sequência 5'-3': TTTTTTTTTTTTCGVTCHATYCCHAAYAAACTAGG Purificação: Dessalinização
1Unidade
Produto/Serviço: Primer Reverse CANIS
Descrição: Identificação: CANIS Reverse Sequência 5'-3': CAAGCATACTCCTAGTAAGGATCCG Tamanho: 170pb Purificação: Dessalinização
1Unidade
Produto/Serviço: Primer Reverse SUS
Descrição: Identificação: SUS Reverse Sequência 5'-3': TCTGATGTGTAATGTATTGCTAAGAAC Tamanho: 219pb Purificação: Dessalinização
1Unidade
Produto/Serviço: Primer Reverse FELIS
Descrição: Identificação: FELIS Reverse Sequência 5'-3': GATTCATGTTAGGGTTAGGAGATCC Tamanho: 180pb Purificação: Dessalinização
1Unidade
Produto/Serviço: Primer Reverse EQUUS
Descrição: Identificação: EQUUS Reverse Sequência 5'-3': TACGTATGGGTGTTCCACTGGC Tamanho: 208pb Purificação: Dessalinização
1Unidade
Produto/Serviço: Primer Forward Cytochrome b 1
Descrição: IDENTIFICAÇÃO: Cytochrome b 1 Forward Sequência 5'-3': CCTTCAGAATGATATTTGTCCTCA Tamanho:358pb Purifcação: Dessalinização
1Unidade
Produto/Serviço: Primer Reverse Cytochrome b 1
Descrição: Identificação: Cytochrome b 1 Reverse Sequência 5'-3': CCATCCAACATCTCAGCATGATGAAA Tamanho: 358pb Purificação: Dessalinização
1Unidade


33607/2022
13/08/2022 16:00:00
Dispensa de licitação
1587/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Mercepton Anti-toxico Injetavel
Descrição: Mercepton Anti-toxico Injetavel, frasco de 100 ml. Fórmula: Cada 100 mL contém: Acetil DL-Metionina ___________________ 500 g Cloreto de Colina ____________________ 200 g Cloridrato de Tiamina _________________ 100 g Cloridrato de Piridoxina________________ 004 g Cloridrato de L-Arginina________________ 060 g Riboflavina ________________________ 002 g Nicotinamida________________________ 050 g Pantotenato de Cálcio ________________ 020 g Glicose ___________________________ 2000 g Veículo q.s.p _______________________ 100 mL
1Frasco


33608/2022
13/08/2022 16:00:00
Dispensa de licitação
1588/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: KINETOMAX
Descrição: COMPRA DE 02 FRASCOS DE KINETOMAX 100ML CADA FRASCO PARA SETOR DE BOVINOS. Kinetomax® é um antibiótico de amplo espectro que promove a rápida recuperação dos animais em dose única Composição: Cada 100mL contém: Enrofloxacino .................................. 10g Veículo q.s.p. ................................ 100mL
2Frasco


33716/2022
12/08/2022 16:00:00
Dispensa de licitação
1590/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CADEIRA DE ESCRITÓRIO MARELLI YOU 213 AREIA COM ESTRUTURA BRANCA
Descrição: FUNÇÕES • Assento estofado com espuma injetada de alta qualidade com densidade e maciez controlada • Encosto fixo e apoio lombar com regulagem de altura, que permitem uma melhor comodidade no ajuste do usuário com a cadeira. • Mecanismo de regulagem de altura por pistão pneumático. • Base de hastes em nylon, com rodízios de Ø50mm. • Apoia Braços com regulagem de altura em 7 posições predefinidas e ampla superfície de apoio. • Ergonômica: Combinando Estética e Personalidade, para atender às normativas vigentes para esse tipo de produto; Garantia contra defeitos de fabricação: 01 ano. INFORMAÇÕES TECNICAS • Regulagem de Altura: Pistão Pneumático; • Material da Estrutura: Nylon; • Material do Assento: Espuma Anatômica em Poliuretano; • Material de Revestimento do Assento: Tecido Sintético; • Material dos Braços: Polipropileno; • Material das Rodas: Nylon 6.6; • Material de Revestimento do Encosto: Poliéster... CÓDIGO REF. 213B1/055CZBRNH LINHA You ALTURA DO PRODUTO 90cm PESO SUPORTADO PELO PRODUTO (KG) 110kg COR Areia e Branco ALTURA DO PRODUTO COM O PISTÃO ELEVADO 101cm ALTURA DO CHÃO AO ASSENTO 47 á 58cm ALTURA DO ASSENTO AO BRAÇO 17 á 25cm LARGURA DO PRODUTO 63cm COMPRIMENTO DO PRODUTO 64,8cm PESO 14kg
2Unidade
Produto/Serviço: Apio para pes
Descrição: Descanso para pés //Descanso para Pés - 911 Acessório indispensável para o complemento de usuário, cadeira e mesa. A estrutura dos materiais e da sua construção garante a qualidade e durabilidade do produto. Tamanho Padrão com regulagem em 07 alturas e movimentos de oscilação na bandeja de aproximadamente 12º a 15º e trava de angulação, o que possibilita manter a mesma inclinação dos pés em todas as alturas, este é um produto para melhor atender a diferentes biótipos. Atende a Norma Reguladora 17 - NR17 Especificações Técnicas Dimensões totais: : 45cmx33cm Material: : Aço 1020 de 2 mm. Garantia: : 03 anos. Dimensões da base: : 30cmx40cm. Regulagens intermediarias: : 7cm / 10cm / 12,5cm / 14,5cm / 16,5cm / 18,5cm, 20cm Acabamento: : Pintura eletrostática. Peso: : 3,9 KG. Regulagens de alturas: : 07 alturas. Proteção de contato com o piso: : 04 batentes Altura min. / altura máxima: : 7cm / 20cm. Revestimento da bandeja: : Piso anti-derrapante de alta durabilidade adesivado a vácuo. Movimentos de oscilação: : 15º. Cor: : Preto. Capacidade de Carga : 40 kg
4Unidade
Produto/Serviço: Telefone sem fio, Pilhas Inclusas e Layout ABNT2
Descrição: Telefone sem fio, Pilhas Inclusas e Layout ABNT2
1Unidade


33717/2022
13/08/2022 16:00:00
Dispensa de licitação
1591/2022 Equipamentos/Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Protetor eletronico
Descrição: rotetor Multifuncional, proteção para seus equipamentos! Não e um Estabilizador!. Protetor Eletrônico 330va Energy Lux é indicado para pc Gamer, tv, Video Game. Esse Protetor Eletrônico Suporta até 330W de potência real. Sua função é proteger os equipamentos dos problemas oriundos da rede elétrica, fornecendo sempre energia limpa de interferência, proporcionando maior vida útil aos produtos a ele conectados. Este protetor é indicado para: PDVs, leitores ópticos, informática, impressoras, produtos eletroeletrônicos, áudio, vídeo, som, telecomunicação, fax, pabx. O Protetor dispõe de sub e sobre tensão, que desliga a saída quando a entrada da rede estiver em níveis perigosos ao seu equipamento. O Protetor não possui a função de estabilizar a rede elétrica. Sua função é proteger os equipamentos dos problemas oriundos da rede elétrica, fornecendo sempre energia limpa de interferência, proporcionando maior vida útil aos produtos a ele conectados. Este Protetor é indicado para: PDVs, leitores ópticos, informática, impressoras, produtos eletroeletrônicos, áudio, vídeo, som, telecomunicação, fax, pabx. O Protetor dispõe de sub e sobre tensão, que desliga a saída quando a entrada da rede estiver em níveis perigosos ao seu equipamento. O Protetor não possui a função de estabilizar a rede elétrica. Características do Protetor Eletrônico 330va tr Lux Energy Lux Proteções: Contra sub e sobre tensão Contra sobre correntes Contra curto circuito na saída Contra choques elétricos Contra surtos de tensão Contra descargas atmosféricas Vantagens: Chave liga/desliga protegida Indicador de rede elétrica Gabinete de alto impacto Filtro de linha com proteção contra surtos Especificação Técnica do Protetor Eletrônico Multifincional 330va tr Lux Energy Lux Marca: tr Lux Energy Lux Modelo: 330A Referência: 1001363 I 330 sku: PROELE330110 Cor: Preto Potência Max: 330VA Fator de potência: 0,65 Distorção Harmônica: Não introduz Tensão de entrada Chave 115V-127V Tensão de saída: 115V Configuração: Monofásica Proteção Disjuntor: 5A/250V Freqência Nominal: 60 hz Protetor de Rede: Sim Protetor de Sub Tensão: Sim Protetor de Sobre Tensão: Sim Protetor de Surtos: Sim Tamanho Cabo de Força: 1100 mm Filtro de Linha rfi-emi: Sim Tomadas Saída 4 + 1 ean: 7898905743824 Dimensões do Produto: 11.5(L)cm X 15.5A)cm X 16.5(P)cm Dimensões do Pacote: 15(L)cm X 15(A)cm x 18(P)cm Peso do Produto com Embalagem: 1000 gramas Peso do Produto: 1000 gramas Conteúdo da Embalagem: Garantia: 36 Meses de garantia **ATENÇÃO, entrada E saída de energia 127V, não faz conversão de 220V para 110V** ** Atenção a potencia máxima suportada pelo aparelho!
4Unidade


33719/2022
13/08/2022 16:00:00
Dispensa de licitação
1592/2022 Equipamentos/Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Nobreak APC Back-UPS 1500VA/825W, Bivolt, Entrada/ 115V Saída - BZ1500XLBI-BR
Descrição: Modelo: BZ1500XLBI-BR Especificações:-Potência Nominal (VA/W): 1500/825. Tensão nominal de entrada (V~): 115/127/220; Faixa de tensão de entrada (V~): 95-140/185-260 V. Conexão de saída: 8 (2P+T - Padrão NBR 14.136). - Interfaces: 4 LEDs (Rede, inversor, bateria e aterramento), Corpo metálico e plástico antichamas, USB - Software de gerenciamento: PowerChute Personal Edition - Expansor de Baterias: Compatível com BZ24XLBP-BR (Max 1) - Topologia Line interactive, Senoidal aproximada Conteúdo da embalagem: - Nobreak APC Back-UPS Garantia: 12 meses de garantia
1Unidade


33734/2022
12/08/2022 16:00:00
Dispensa de licitação
1593/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AgraQuant Aflatoxinas (1-20ppb) - 96 poços
Descrição: AgraQuant Aflatoxinas (1-20ppb) - 96 poços Validade: no mínimo 6 meses a contar da data de entrega do material. ***NÃO ORÇAR KITS 48 POÇOS OU 4-40***
1Kit
Produto/Serviço: AgraQuant Desoxinivalenol (250-5000 ppb) - 96 poços
Descrição: AgraQuant Desoxinivalenol (250-5000 ppb) - 96 poços Validade: no mínimo 6 meses a contar da data de entrega do material.
1Kit
Produto/Serviço: AgraQuant Fumonisina (250-5000 ppb) - 96 poços
Descrição: AgraQuant Fumonisina (250-5000 ppb) - 96 poços Validade: no mínimo 6 meses a contar da data de entrega do material.
1Kit


33819/2022
15/08/2022 16:00:00
Dispensa de licitação
1594/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Placas de sinalização de orientação e salvamento COM EFEITO FOTOLUMINESCENTE
Descrição: Placas de sinalização de orientação e salvamento COM EFEITO FOTOLUMINESCENTE: - 8 placas com seta para a direita (S1); - 5 placas com seta para a esquerda (S2); - 6 placas de saída (S12); - 6 placas de saída com seta para baixo.
25Unidade


33917/2022
14/08/2022 16:00:00
Dispensa de licitação
1597/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: DISCOS PARA ANTIBIOGRAMA - Espectinomicina
Descrição: DISCOS PARA ANTIBIOGRAMA - Espectinomicina
400Unidade
Produto/Serviço: DISCOS PARA ANTIBIOGRAMA - Gentamicina
Descrição: DISCOS PARA ANTIBIOGRAMA - Gentamicina
400Unidade
Produto/Serviço: DISCOS PARA ANTIBIOGRAMA - Imipenem
Descrição: DISCOS PARA ANTIBIOGRAMA - Imipenem
400Unidade


33918/2022
14/08/2022 16:00:00
Dispensa de licitação
1598/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AgraQuant T2-Toxina (20-500 ppb) - 96 poços
Descrição: AgraQuant T2-Toxina (20-500 ppb) - 96 poços Validade: no mínimo 6 meses a contar da data de entrega do material.
1Kit
Produto/Serviço: AgraQuant Zearalenone (40-1000 ppb) - 96 poços
Descrição: AgraQuant Zearalenone (40-1000 ppb) - 96 poços Validade: no mínimo 6 meses a contar da data de entrega do material.
1Kit


33954/2022
14/08/2022 16:00:00
Dispensa de licitação
1599/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Álcool Metílico P.A
Descrição: Álcool Metílico P.A, frasco 1 litro
6Litro


33955/2022
14/08/2022 16:00:00
Dispensa de licitação
1600/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Solução de Ringer com Lactato em Sistema Fechado 250ml, caixa c/35 unidades
Descrição: Solução de Ringer com Lactato 250ml, Bolsas de PVC em Sistema Fechado, caixa com 35 unidades
1Caixa


34037/2022
16/08/2022 16:00:00
Dispensa de licitação
1602/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Cadeira mocho Alto Preto OU SIMILAR
Descrição: *Capacidade de Suportar ate 120 KG *Altura do chão ao assento entre 62 e 75 cm *Base giratória. *Rodízios Duplos. *Descanso para os pés com Regulagem. *Espuma injetada de alta densidade. *Diâmetro mínimo do assento: 36 CM *Altura mínima da espuma do assento 7 CM *Tamanho mínimo do encosto 36 X 30 *Altura mínima da espuma do encosto de 3,5 CM *L sanfonado. *Pistão a gás com regulagem por uma Alavanca.
5Unidade
Produto/Serviço: Banqueta Sem Encosto
Descrição: Estrutura Em Tubo de Aço, Pintura Epóxi, Assento Em Mdf Revestido De Courino Preto e Espuma de alta densidade Medidas Aproximadas: 70cm De Altura e 30cm De Diâmetro
4Unidade
Produto/Serviço: Impressora multifuncional EcoTank L375
Descrição: Impressora multifuncional EcoTank L375 Tecnologia de impressão: jato de tinta. Entrada USB. Suporta papel tamanho A4, A5, A6, B5, Carta, Legal, Ofício, Envelope C6, Envelope DL, Envelope N10, Envelope 200 x 132 mm, 10 x 15 cm, 13 x 18 cm.
1Unidade


34039/2022
14/08/2022 16:00:00
Dispensa de licitação
1603/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Detergente para pia ( YPE, LIMPOL ou SIMILAR)
Descrição: Material de Consumo
30Unidade
Produto/Serviço: limpador multi uso 500ml (veja OU SIMILAR)
Descrição: Material de Consumo
20Unidade
Produto/Serviço: Pacote de toalha de papel branca, interfolhadas, 22,5x21,5cm gramatura 36
Descrição: Material de Consumo
50Unidade
Produto/Serviço: FITA ADESIVA TRANSPARENTE PARA EMPACOTAMENTO 45MM X 45M
Descrição: Material de Consumo
30Unidade
Produto/Serviço: RESMAS DE PAPEL A4
Descrição: Material de Consumo
30Unidade
Produto/Serviço: Luva Procedimento Látex Descarpack C/ 100 Unid. (P)
Descrição: Material de Consumo
30Unidade
Produto/Serviço: Alcool liquido 70% galão de 5litros
Descrição: Material de Consumo
4Unidade
Produto/Serviço: Fichário A4 / 4 Argolas / tons verde pastel R4S 12421
Descrição: Material de Consumo
10Unidade
Produto/Serviço: Etiqueta ink-jet/laser A4 17x31 348
Descrição: Material de Consumo
3Unidade
Produto/Serviço: Cartucho de Toner Compatível com HP 435A 436A 285A 1005 1006
Descrição: Material de Consumo
10Unidade
Produto/Serviço: Tinta Acrilica Emborrachada 3,6 Litros / Cor Cinza
Descrição: Material de Consumo
2Unidade
Produto/Serviço: Display Expositor Acrílico Porta Papel A4 30x21cm De Parede
Descrição: Material de Consumo
15Unidade


34053/2022
14/08/2022 16:00:00
Dispensa de licitação
1604/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Ácido Bórico PA
Descrição: Fórmula Molecular: H3BO3 Peso Molecular: 61,83 g/mol Características do produto: Sólido branco inodoro. Solubilidade: em água: 50g/l Ponto de fusão: 185ºC Pureza: > 99,5% Embalagem e rotulagem: Armazenado em frasco escuro. Rotulado com descrição do sólido, data de fabricação, validade, lote e volume. Validade: Validade mínima de 1 ano a partir do recebimento no laboratório. Certificado de análise: Deve ser entregue acompanhado do certificado de análise ou solicitado ao fornecedor.
500Grama


34088/2022
14/08/2022 16:00:00
Dispensa de licitação
1606/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Prato descartável, fundo, 14,9 cm diâmetro
Descrição: Prato descartável, fundo, 14,9 cm diâmetro para água ou outros líquidos.
1000Unidade


34089/2022
14/08/2022 16:00:00
Dispensa de licitação
1607/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: copo descartável 200ml
Descrição: copo descartável 200 ml.
6Caixa


34091/2022
14/08/2022 16:00:00
Dispensa de licitação
1609/2022 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: bucha n°8 com parafuso
Descrição: bucha n°8 com parafuso
5Peça
Produto/Serviço: Abraçadeira tipo "D" em chapa de aço
Descrição: ABRAÇADEIRA TIPO "D" COM CUNHA DIAM. 1"
5Peça
Produto/Serviço: Cabo
Descrição: CABO PP 1Kv 4 VIAS 1,5mm²
8Metro
Produto/Serviço: Tubulação
Descrição: TUBULAÇÃO DE COBRE Ø6,35mm (1/4")
7Metro
Produto/Serviço: Tubulação
Descrição: TUBULAÇÃO DE COBRE Ø12,7mm (1/2")
7Metro
Produto/Serviço: Tubo
Descrição: TUBO ISOLANTE ELASTOMÉRICO PARA TUBO DE COBRE 1/4” ESPESSURA 13mm PRETO ESPONJOSO
8Metro
Produto/Serviço: Tubo
Descrição: TUBO ISOLANTE ELASTOMÉRICO PARA TUBO DE COBRE 1/2” ESPESSURA 13mm PRETO ESPONJOSO
8Metro
Produto/Serviço: Fita
Descrição: FITA PVC PARA REFRIGERAÇÃO - COR BRANCA
1Rolo
Produto/Serviço: Tubo
Descrição: TUBO PVC COLA DIAM. 25mm
10Metro
Produto/Serviço: Joelho
Descrição: JOELHO 90º PVC COLA DIAM. 25mm
8Peça
Produto/Serviço: Cola
Descrição: COLA PARA PVC - BISNAGA
1Peça


34337/2022
15/08/2022 16:00:00
Dispensa de licitação
1615/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Balança de precisão com capacidade de pesagem de até 5 kg
Descrição: Balança eletrônica de precisão, capacidade de 5 kg, divisão 0,1 (Sensibilidade e reprodutibilidade = 0,1), Aprovada INMETRO, tara subtrativa em toda a escala, Classe de exatidão: II, bivolt automático de 100 a 230 Vca.
1Unidade