ÁREA DO FORNECEDOR

ACESSO RESTRITO












Destaques


A FEPE recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
15355/2020
05/08/2021 00:00:00
Processo Seletivo Simplificado
5/2020 Contratação de Outros Serviços
Edital 03.2020_Seleção de Candidatos a Estágio Não Obrigatório MEDICINA.pdf
Convocação de Entrevista
Resultado da Prova de Entrevista
Resultado Final e Convocação para Entrega de Documentos

Produto/ServiçoQuant.Unidade
Produto/Serviço: Contratação de Pessoa Física
Descrição: 01 vaga para Estagiário Medicina. Bolsa : R$ 400,00 (quatrocentos reais) + Auxílio transporte – R$ 50,00 (cinquenta reais/mês). Carga Horária: A carga horária do estágio será de 4 (quatro) horas diárias, perfazendo um total de 20 (vinte) horas semanais – PERÍODO DIURNO. Local: será desenvolvido no Centro de Treinamento Esportivo - CTE localizado na Av. Alfredo Camarate, nº 617 - São Luiz, Belo Horizonte / MG
1Unidade


17126/2020
12/03/2021 16:00:00
Dispensa de licitação
630/2020 Contratação de Outros Serviços
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Serviço instalação ar condicionado
Descrição: Instalação ar condicionado de parede. A instalação será realizada em janela, necessitando de apoio.
1Unidade


22517/2020
12/03/2021 18:00:00
Dispensa de licitação
856/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Reagente- Tween 0,5%
Descrição: Solução salina tamponada com Tween 0,5% Sigma-Aldrich P3563-10PAK 10pkg
1Frasco
Produto/Serviço: Reagente- Tris-HCL
Descrição: Tris-HCL 1M Sigma-Aldrich T5941-100G =99.0% 100g
1Frasco
Produto/Serviço: Reagente- Ditiotreitol
Descrição: Ditiotreitol Sigma-Aldrich D0632-1G =98.0% 1g
1Frasco
Produto/Serviço: Reagente HCL
Descrição: HCL (6N) Sigma-Aldrich H1758-100ML 100ml
1Frasco
Produto/Serviço: Reagente- Anticorpo primário–Anti-5-metilcitosina
Descrição: Anticorpo primário–Anti-5-metilcitosina Invitrogen MA5-24694 1 mg/mL 50 µg
1Frasco
Produto/Serviço: Reagente- Anticorpo secundário - FITC
Descrição: Anticorpo secundário - FITC Invitrogen A-11008 2 mg/mL 1mg
1Frasco
Produto/Serviço: Reagente- Epidermal growth factor
Descrição: Epidermal growth factor Sigma-Aldrich E9644 2 mg
1Frasco


2473/2021
09/03/2021 16:00:00
Inexigibilidade de licitação
8/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Licenciamento de uso à FEPE da ferramenta de software “SISLAB” para uso interno no Laboratório de Análise de Leite da UFMG
Descrição: Licenciamento de uso à FEPE da ferramenta de software “SISLAB” para uso interno no Laboratório de Análise de Leite da UFMG, desenvolvido e de propriedade da Associação Paranaense de Criadores de Bovinos da Raça Holandesa (APCBRH) - CUSTO MENSAL DE UTILIZAÇÃO DO SISTEMA será de 01 (um) salário mínimo nacional por mês, com reajuste automático com o mesmo; SOMADO A R$ 0,10 (dez centavos de real) por amostra processada pelo sistema, com pagamento mensal, com reajuste na mesma data que o salário mínimo seguindo o mesmo índice. O sistema SISLAB pertence e foi desenvolvido pela Associação Paranaense de Criadores de Bovinos da Raça Holandesa (APCBRH), sendo portanto, fornecedor exclusivo. REQUER ELABORAÇÃO DE CONTRATO DE UTILIZAÇÃO DO SOFTWARE DURANTE O PERÍODO DE VIGÊNCIA DO PROJETO
24Mês
Produto/Serviço: Modulo WEB do sistema SISLAB para acesso online pelos clientes
Descrição: Modulo WEB para acesso online pelos clientes, com o SEGUINTE custo adicional: 01 (um) salário mínimo nacional por mês, com reajuste automático com o mesmo SOMADO A R$ 0,05 (cinco centavos de real) por amostra processada pelo sistema, com pagamento mensal, com reajuste na mesma data que o salário mínimo seguindo o mesmo índice. REQUER ELABORAÇÃO DE CONTRATO DE UTILIZAÇÃO DO SOFTWARE DURANTE O PERÍODO DE VIGÊNCIA DO PROJETO.
24Mês
Produto/Serviço: Implantação de módulos adicionais no sistema SISLAB
Descrição: Implantação de módulos adicionais no sistema SISLAB visando atualizações, melhorias e adequações às demandas estabelecidas pelo Ministério da Agricultura, Pecuária e Abastecimento.
1Unidade


2589/2021
09/03/2021 16:00:00
Inexigibilidade de licitação
9/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AMOSTRAS DE REFERÊNCIA PARA CALIBRAÇÃO DE EQUIPAMENTOS DE ANÁLISE DE URÉIA EM LEITE CRU - ITEM CRÍTICO PARA REALIZAÇÃO DAS ANÁLISES PELO LABORATÓRIO
Descrição: Características do produto: Amostras de leite cru de vaca adicionado de conservante Bronopol. Rótulo contendo: Descrição da amostra e identificação unívoca. Data de validade e lote impressos no rotulo do frasco. Temperatura de conservação entre 1 °C e 5 °C. Certificado de análise: Deve ser enviado via email pelo fornecedor. Dados do rótulo. Lote, validade e fabricação do produto impressos no certificado de análise. Dados do relatório de ensaio. Integridade da embalagem e da amostra. INSPEÇÃO ANTES DO USO: Observação da integridade da amostra
24Kit
Produto/Serviço: AMOSTRAS DE REFERÊNCIA PARA CALIBRAÇÃO DE EQUIPAMENTOS DE ANÁLISE DE COMPOSIÇÃO (GORDURA, PROTEÍNA, LACTOSE E SÓLIDOS TOTAIS) EM LEITE CRU - ITEM CRÍTICO PARA REALIZAÇÃO DAS ANÁLISES PELO LABORATÓRIO
Descrição: Características do produto: Amostras de leite cru de vaca adicionado de conservante Bronopol. Rótulo contendo: Descrição da amostra e identificação unívoca. Data de validade e lote impressos no rótulo, Temperatura de conservação entre 1 °C e 5 °C. Certificado de análise: Deve ser enviado via email pelo fornecedor. Dados do rótulo. Lote, validade e fabricação do produto impressos no certificado de análise. Dados do relatório de ensaio. Integridade da embalagem e da amostra. INSPEÇÃO ANTES DO USO: Observação da integridade da amostra
24Kit
Produto/Serviço: AMOSTRAS DE REFERÊNCIA PARA CALIBRAÇÃO DE EQUIPAMENTOS DE ANÁLISE DE CASEINA EM LEITE CRU - ITEM CRÍTICO PARA REALIZAÇÃO DAS ANÁLISES PELO LABORATÓRIO
Descrição: Características do produto: Amostras de leite cru de vaca adicionado de conservante Bronopol. Rótulo contendo: Descrição da amostra e identificação unívoca. Data de validade e lote impressos no rotulo do frasco. Temperatura de conservação entre 1 °C e 5 °C. Certificado de análise: Deve ser enviado via email pelo fornecedor. Dados do rótulo. Lote, validade e fabricação do produto impressos no certificado de análise. Dados do relatório de ensaio. Integridade da embalagem e da amostra. INSPEÇÃO ANTES DO USO: Observação da integridade da amostra
12Kit
Produto/Serviço: MATERIAL DE REFERÊNCIA (MR) PARA CONTAGEM DE CÉLULAS SOMÁTICAS - ITEM CRÍTICO PARA REALIZAÇÃO DAS ANÁLISES PELO LABORATÓRIO CÉLULAS SOMÁTICAS EM LEITE CRU
Descrição: Características do produto: Kit com 3 frascos contendo amostras padrão de leite cru de vaca adicionado de conservante Bronopol para calibração do equipamento de contagem de células somáticas sendo cada um de uma cor dispostos da seguinte forma: Frasco azul baixa contagem de células somáticas, Frasco verde média contagem de células somáticas, Frasco vermelho alta contagem de células somáticas. Rótulo contendo: Fabricante, descrição da amostra e identificação unívoca. Temperatura de conservação entre 1 °C e 5 °C. Certificado de análise: Deve ser enviado via email pelo fornecedor. Dados do rótulo. Lote e validade do produto. Dados do relatório de ensaio. Integridade da embalagem e da amostra INSPEÇÃO ANTES DO USO: Observação da integridade da amostra
48Kit


3725/2021
12/03/2021 16:00:00
Dispensa de licitação
165/2021 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: TORNOZELEIRA
Descrição: COMPRA DE 16 TORNOZELEIRAS PARA VACAS NA COR BRANCA PARA SETOR DE BOVINOS.
16Unidade


3891/2021
31/03/2021 16:00:00
Importação
1/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: BACTERIAL CONTROL SAMPLE - caixa contendo 25 frascos
Descrição: Características do produto: Sólido branco, contendo cultura de bactérias. Solubilidade: Solúvel Embalagem e rotulagem: Armazenado em frasco transparente de 1g. Deve ser mantido à temperatura abaixo de -15 ºC Rotulado com descrição do sólido, data de fabricação, validade, lote e volume. Validade: Validade mínima de 1 ano a partir do recebimento no laboratório. Certificado de análise: Deve ser solicitado ao fornecedor. Fornecedor exclusivo – FOSS ELETRIC
1Caixa
Produto/Serviço: BUFFER POWDER - caixa contendo 8 pacotes DE 600 GRAMAS
Descrição: Características do produto: Sólido branco, tóxico, composto de sais inorgânicos e orgânicos (carbonatodesódio, EDTA saldihidratadodissódio). Solubilidade: Solúvel. Embalagem e rotulagem: Armazenado em pacotes laminados de 500 g. Rotulado com descrição do sólido, data de validade, lote e volume. Validade: Validade mínima de 1 ano a partir do recebimento no laboratório. . Certificado de análise: Deve ser solicitado ao fornecedor. Fornecedor exclusivo – FOSS ELETRIC.
7Caixa
Produto/Serviço: DETERGENT BACTOSCAN - caixa contendo 8 FRASCOS DE 500 mL
Descrição: Características do produto: Líquido amarelado, composto de solução de polioxietileno oleil éter pH: 7,4. Solubilidade: Solúvel Embalagem e rotulagem: Armazenado em frasco transparente de 500 mL. Rotulado com descrição do líquido, data de validade, lote e volume. Validade: Validade mínima de 1 ano a partir do recebimento no laboratório. Certificado de análise: Deve ser solicitado ao fornecedor. Fornecedor exclusivo – FOSS ELETRIC.
7Caixa
Produto/Serviço: STAINING MEDIUM - caixa contendo 4 frascos DE 100 mL
Descrição: Características do produto: Líquido avermelhado, composto por brometo de etídio. Solubilidade: Solúvel Embalagem e rotulagem: Armazenado em frasco âmbar de 100 mL. Rotulado com descrição do líquido, data de fabricação, validade, lote e volume. Validade: Validade mínima de 1 ano a partir do recebimento no laboratório. Certificado de análise: Deve ser solicitado ao fornecedor. Fornecedor exclusivo – FOSS ELETRIC.
7Caixa
Produto/Serviço: ENZYME 150 - caixa contendo 25 frascos de 50 mL
Descrição: Características do produto: Líquido marrom, odor característico. pH entre 3,3 - 9,5. Embalagem e rotulagem: Armazenado em frasco transparente de 46 mL. Deve ser mantido à temperatura de 2 º a 8 ºC. Rotulado com descrição do líquido, data de fabricação, validade, lote e volume. Validade: Validade mínima de 1 ano a partir do recebimento no laboratório. Certificado de análise: Deve ser solicitado ao fornecedor. Fornecedor exclusivo – FOSS ELETRIC.
7Caixa
Produto/Serviço: PARTICLE CONTROL SAMPLE
Descrição: Características do produto: Líquido turvo, inodoro. Composto de solução de partículas, sais orgânicos e inorgânicos. pH 8. Solubilidade: Solúvel. Embalagem e rotulagem: Armazenado em frasco âmbar. Deve ser mantido à temperatura de 2 º a 8 ºC. Rotulado com descrição do líquido, data de fabricação, validade, lote e volume. Validade: Validade mínima de 1 ano a partir do recebimento no laboratório. Certificado de análise: Deve ser solicitado ao fornecedor. Fornecedor exclusivo – FOSS ELETRIC
1Frasco
Produto/Serviço: RINSE CONCENTRATE - caixa contendo 4 frascos de 1000 mL
Descrição: Características do produto: Líquido turvo, composto por água, sais orgânicos e inorgânicos. pH: 9 Solubilidade: Solúvel. Embalagem e rotulagem: Armazenado em frasco opaco. Rotulado com descrição do líquido, data de fabricação, validade, lote e volume. Validade: Validade mínima de 1 ano a partir do recebimento no laboratório. Certificado de análise: Deve ser solicitado ao fornecedor. Fornecedor exclusivo – FOSS ELETRIC
1Caixa


3892/2021
29/03/2021 14:00:00
Dispensa de licitação
166/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Centriguga refrigerada para microtubos, rotor fixo capacidade minima 28 tubos 1,5- 2 ml, padrão Toth TH.9300R.2 ou superior
Descrição: MICROCENTRÍFUGA REFRIGERADA- Centrífuga Digital para Microtubos com Refrigeração – -Voltagem: 220V / 60 Hz -Painel de Controle eletrônico – Touch Screen, Colorido. -Rotação 200 a 16.000 RPM -Temperatura de Trabalho - 10oC a +40oC -Rotor de Ângulo Fixo: Capacidade para 28 x 1,5 ml a 2,0 ml - -Velocidade até 16.000 RPM -Garantia minima de 1 ano
1Unidade


3955/2021
12/03/2021 16:00:00
Dispensa de licitação
171/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Cartucho de Bioquímica Tipo EC8+ - CAIXA C/ 25 UNIDADES
Descrição: Cartucho descartável Bioquímica - Tipo Ec8+ - (Uréia Nitrogenada, Glicose, Cl, Na, K, Hct, Hb, pH, PCO2, TCO2, HCO3, BEecf, Anion Gap). CAIXA COM 25 UNIDADES. VALIDADE SUPERIOR A 6 MESES
2Caixa


4039/2021
12/03/2021 16:00:00
Dispensa de licitação
190/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Balde de plástico
Descrição: Baldes de plástico de cor preta tampa e alça, capacidade de 60 litros.
24Unidade


4172/2021
12/03/2021 16:00:00
Dispensa de licitação
193/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: recarga gás nitrogênio
Descrição: Recarga de 250 litros de nitrogênio líquido.
250Litro


4175/2021
12/03/2021 16:00:00
Dispensa de licitação
196/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AMOXICILINA 14G/100ML +CLAVULANATO DE POTÁSSIO 3,5G/100ML FRASCO C/ 50 ML (MEDICAMENTO VETERINÁRIO)
Descrição: MEDICAMENTO VETERINÁRIO AMOXICILINA 14G/100ML +CLAVULANATO DE POTÁSSIO 3,5G/100ML FRASCO C/ 50 ML REGISTRO NO MAPA/MS. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA NA FARMÁCIA. Especificação: Frasco 100ml
5Frasco


4191/2021
10/03/2021 14:00:00
Dispensa de licitação
198/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Tricrômio de Masson - Histokit para 60 Colorações
Descrição: Kit para coloração histológica (60 colorações)
1Unidade
Produto/Serviço: Vermelho Congo - Histokit para 60 Colorações
Descrição: Kit para coloração histológica.
1Unidade
Produto/Serviço: Ziehl Neelsen - Histokit para 60 Colorações
Descrição: Kit para coloração histológica
1Unidade
Produto/Serviço: Reticulina - Histokit para 60 Colorações
Descrição: Kit para coloração histológica.
1Unidade
Produto/Serviço: QIAEX II Gel Extraction Kit (500)
Descrição: O referido produto precisa ser necessariamente desta marca devido à experimentação já estar em andamento com produto semelhante, podendo comprometer os resultados caso haja alteração da marca do produto em questão.
1Unidade
Produto/Serviço: DEPC-Treated Water (500mL)
Descrição: O referido produto precisa ser necessariamente desta marca devido à experimentação já estar em andamento com produto semelhante, podendo comprometer os resultados caso haja alteração da marca do produto em questão.
1Unidade


4790/2021
12/03/2021 17:00:00
Dispensa de licitação
204/2021 Equipamentos/Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: memória computador
Descrição: Memória para computador, modelo DDR3 1333MHz 8GB.
1Unidade


4904/2021
09/03/2021 16:00:00
Dispensa de licitação
205/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Lâminas para microscopia classe A com borda fosca 26x76 (50 uni)
Descrição: Lâminas para microscopia classe A com borda fosca 26x76 (50 uni)
50Caixa


4906/2021
10/03/2021 11:00:00
Dispensa de licitação
207/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CÁLCIO, GLUCONATO E ASSOCIAÇÕES FRASCO C/ 500 ML
Descrição: CÁLCIO, GLUCONATO E ASSOCIAÇÕES FRASCO C/ 500 ML. REGISTRO NO MAPA. Sugestão: Calfoz 500ml, marca: Calbos VALIDADE MÍNIMA DE 1 ANO NA DATA DE ENTREGA
6Frasco


4913/2021
09/03/2021 16:00:00
Dispensa de licitação
208/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Avental Plumbífero
Descrição: Avental Plumbífero Flexível de 0,50 mm , revestido em Nylon lavável , possui alças cruzadas, sem proteção nas constas .
2Unidade
Produto/Serviço: Colar Plumbífera
Descrição: Colar Plumbífera de 0,50 mm - Protetor de tireoides .
2Unidade


4942/2021
09/03/2021 17:00:00
Dispensa de licitação
210/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Anticorpo anti-MUC2 - BIORBYT 100 UG
Descrição: 100UG - BIORBYT MUC2 ANTIBODY TEMPERATURE: 4°C **DESCRIÇÃO: ANTICORPO. RUO (RESEARCH USE ONLY)** 0002 ORB372331 BIORBYT
1Frasco
Produto/Serviço: Anticorpo anti MUC5AC 100 UG BIORBYT
Descrição: 100UG - BIORBYT MUC5AC ANTIBODY TEMPERATURE: 4°C **DESCRIÇÃO: ANTICORPO. RUO (RESEARCH USE ONLY)** 0001 ORB388467 BIORBYT
1Frasco


4943/2021
09/03/2021 16:00:00
Dispensa de licitação
211/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CIMENTO ÓSSEO CAIXA C/ 40G
Descrição: CIMENTO ÓSSEO CAIXA C/ 40G - CIMENTO CIRÚRGICO ORTOPÉDICO (USO EXCLUSIVO VETERINÁRIO) CONTEÚDO DE CADA CAIXA: 01 EMBALAGEM acondicionada ESTÉRIL; Contendo 40G de pó estéril de polimetilmetacrillato. 01 - AMPOLA acondicionada ESTÉRIL; Contendo 20ML de liquido estéril de metilmetacrilato. Validade de no mínimo 1 ano na dada de entrega
5Caixa


5171/2021
09/03/2021 16:00:00
Dispensa de licitação
217/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Ponteira 1000ul pacote com 1000 unidades, livre de DNAse e RNAse
Descrição: Material de Consumo
5Pacote
Produto/Serviço: Ponteira 10ul filtro pacote com 1000 unidades, livre de DNAse e RNAse
Descrição: Material de Consumo
10Pacote


5251/2021
12/03/2021 16:00:00
Dispensa de licitação
219/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FIO P/ SUTURA NYLON 2-0 - CÓDIGO 1174T -
Descrição: Fio de sutura de poliamida, tamanho 2-0, Comprimento do fio 75 cm, formato da agulha 3/8 círculo, comprimento da agulha 40mm. (NYLON). Caixa com 24 unidade
216Unidade


5346/2021
12/03/2021 17:00:00
Dispensa de licitação
222/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: GESSO SINTÉTICO 10 CM x 3,6 M
Descrição: ATADURA DE GESSO SINTÉTICO 10 CM - atadura confeccionada com 100% em fibra de poliester, impregnada com uma emulsão ativada de resina de poliuretano, medindo 10cm X 3,6 m. Rolo embalado à vácuo em embalagem de alumínio individual contendo dados de identificação, número de lote, data de fabricação, prazo de validade, dimensões, composição, responsável técnico.
20Unidade


5452/2021
12/03/2021 16:00:00
Dispensa de licitação
224/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SERINGA DESCARTÁVEL 20ML
Descrição: SERINGA DESCARTÁVEL 20ML - Seringa descartável 20 ml; INDISPENSÁVEL POSSUIR BICOS LUER LOCK; confeccionada em polipropileno; com siliconização interna e stopper mais fino; com anel de retenção; embalagem unitária contendo número do lote; data de fabricação e data de validade. registro na anvisa/ms. validade de no mínimo 1 ano.
3000Unidade
Produto/Serviço: SERINGA 01 ML COM AGULHA
Descrição: SERINGA 01 ML - seringa descartável de 1 ml, tipo insulina, de 100 ui, 26 g1/2´com agulha 0,45 x 0,13 mm embalada com capa protetora, escala graduada por unidade insulínica, volume residual de 0,01 ml. estéril, atóxica, apirogênica. registro na anvisa/ms. validade de no mínimo 1 ano. Caixa com 150 unidade. DIVIDIR ENTREGA EM DUAS VEZES
3000Unidade
Produto/Serviço: SERINGA DESCARTÁVEL 3ML COM AGULHA, BICO LUER LOCK
Descrição: SERINGA DESCARTÁVEL 3ML COM AGULHA - Seringa descartável 03 ml c/ agulha ; INDISPENSÁVEL POSSUIR BICOS LUER LOCK; confeccionada em polipropileno; com siliconização interna e stopper mais fino; com anel de retenção; embalagem unitária contendo número do lote; data de fabricação e data de validade. registro na anvisa/ms. validade de no mínimo 1 ano.
4000Unidade
Produto/Serviço: SERINGA 05 ML COM AGULHA
Descrição: SERINGA DESCARTÁVEL 5ML COM AGULHA - Seringa descartável 05 ml c/ agulha ; INDISPENSÁVEL POSSUIR BICOS LUER LOCK; confeccionada em polipropileno; com siliconização interna e stopper mais fino; com anel de retenção; embalagem unitária contendo número do lote; data de fabricação e data de validade. registro na anvisa/ms. validade de no mínimo 1 ano.
2800Unidade
Produto/Serviço: SERINGA DESCARTÁVEL 10ML COM AGULHA, BICO LUER LOCK
Descrição: SERINGA DESCARTÁVEL 10ML COM AGULHA - Seringa descartável 10 ml c/ agulha; INDISPENSÁVEL POSSUIR BICOS LUER LOCK; confeccionada em polipropileno; com siliconização interna e stopper mais fino; com anel de retenção; embalagem unitária contendo número do lote; data de fabricação e data de validade. registro na anvisa/ms. validade de no mínimo 1 ano.
8000Unidade
Produto/Serviço: SERINGA DESCARTÁVEL 60ML SEM AGULHA LUER LOCK
Descrição: Seringa descartável 60 ml s/ agulha; possui bico LUER LOCK catéter central; confeccionada em polipropileno; com siliconização interna e stopper mais fino; com anel de retenção; embalagem unitária contendo número do lote; data de fabricação e data de validade. Registro na anvisa/ms. validade de no mínimo 1 ano
20Unidade


5453/2021
12/03/2021 17:00:00
Dispensa de licitação
225/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: COMPRESSA CIRÚRGICA, CAMPO OPERATÓRIO 45X50, DESCARTÁVEL, ESTÉRIL, PACOTE COM 5 UNIDADES
Descrição: COMPRESSA CIRÚRGICA, CAMPO OPERATÓRIO 45X50, DESCARTÁVEL, ESTÉRIL, PACOTE COM 5 UNIDADES
500Pacote
Produto/Serviço: COMPRESSA CIRÚRGICA, CAMPO OPERATÓRIO 45X50, DESCARTÁVEL, ESTÉRIL, PACOTE COM 2 UNIDADES
Descrição: COMPRESSA CIRÚRGICA, CAMPO OPERATÓRIO 45X50, DESCARTÁVEL, ESTÉRIL, PACOTE COM 2 UNIDADES
500Pacote


5454/2021
12/03/2021 16:00:00
Dispensa de licitação
226/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Pulseiras - Colar
Descrição: Modelo: VINYL AV GR BRANCA – COM IMPRESSÃO Personalizada Hospital Veterinário- UFMG, Nome :Prontuário , Proprietário: .
1000Unidade
Produto/Serviço: Pulseira - Colar Extensor
Descrição: Modelo: VINYL AV GR BRANCA – SEM IMPRESSÃO
1000Unidade


5457/2021
12/03/2021 18:00:00
Dispensa de licitação
228/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ALFAINTERFERONA 3.000.000 UI 2B - CAIXA COM 5 FRASCOS-AMPOLA DE 1ML
Descrição: ALFAINTERFERONA 3.000.000 UI 2B - CAIXA COM 5 FRASCOS-AMPOLA DE 1ML. REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO NA ENTREGA NA FARMÁCIA
5Unidade
Produto/Serviço: DOXORRUBICINA,CLORIDRATO 10MG F/A PO LIOFILIZADO.
Descrição: DOXORRUBICINA,CLORIDRATO 10MG F/A PO LIOFILIZADO. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO
10Frasco


5460/2021
12/03/2021 16:00:00
Dispensa de licitação
231/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ATRACÚRIO BESILATO 10MG/ML - AMPOLA 2,5ML
Descrição: ATRACÚRIO 10 MG/ML - AMPOLA C/ 2,5 ML.RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO
25Ampola


5463/2021
12/03/2021 16:00:00
Dispensa de licitação
234/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: bota de plástico
Descrição: Bota de segurança cano longo tipo impermeável, de uso profissional. Confeccionada em policloreto de vinila (PVC) injetado em uma só peça. Antiderrapante especial e reforçado com ranhuras na planta e no salto. Em conformidade com a ISO 20347:2008 e ISO 20344:2008; Comprimento do cano: 33,5cm / Comprimento total (incluindo o salto): 37,5cm. 05 pares número 43 05 pares número 42 05 pares número 41 05 pares número 40 05 pares número 39 05 pares número 38 05 pares número 37 05 pares número 36
40Par


5465/2021
12/03/2021 16:00:00
Dispensa de licitação
235/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Acetato de Etila
Descrição: Acetato de etila P.A. 100%
1Litro
Produto/Serviço: Clorofórmio P.A.
Descrição: Clorofórmio P.A. 100%
2Litro


5889/2021
09/03/2021 16:00:00
Dispensa de licitação
254/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: OLIGONUCLEOTIDEOS 02 OLIGOS SINTETIZADOS EM ESCALA INICIAL DE 25 NMOL, TOTALIZANDO 41 BASES, RENDIMENTO MINIMO GARANTIDO DE 12 NMOL. PURIFICACAO PADRAO. TODOS OS OLIGOS SAO CHECADOS INDIVIDUALMENTE NO CONTROLE DE QUALIDADE (QC) POR ESPECTROMETRIA DE MASSA
Descrição: Nome do gene: TFF3 (Trefoil factor 3), Número de acesso: NM_001243483.1. Sequência foward: CAG GAT GTT CTG GCT GCT AGT G Sequência reverse: GCA GTC CAC CCT GTC CTT G
1Par


5890/2021
10/03/2021 16:00:00
Dispensa de licitação
255/2021 Contratação de Outros Serviços
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Sistema de transmissão de imagens médicas.
Descrição: SERVIÇOS DE INSTALAÇÃO DE SERVIDOR E CLIENTE PACS DE CÓDIGO LIVRE E ACESSO VIA WEB. - Implantação do sistema de transmissão de imagens médicas para o Hospital Veterinário, que consiste no envio de imagens médicas para salas de laudo, sala de aulas práticas da disciplina Diagnóstico por imagem em veterinária (CCV036), consultórios, gabinetes dos professores da área, bem como disponibilização de ferramentas necessárias para laudagem de exames de imagem, disponibilizadas em work Stations.
1Unidade


6074/2021
10/03/2021 16:00:00
Dispensa de licitação
257/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Agarose, frasco 100g, K9-9100 ou superior
Descrição: Agarose, frasco 100g, K9-9100 ou superior
1Frasco
Produto/Serviço: Saco para autoclave 20 Litros- tamanho 40X60CM. Emb C/20 und.
Descrição: Saco para autoclave 20 Litros- tamanho 40X60CM. Emb C/20 und. especificado para resistir 5 horas a 121 graus Celcius Material: PEAD (Polietileno de alta densidade). espessura 0,010 micrômetros
5Pacote
Produto/Serviço: Placa de petri descartáveis 90X15, estéreis, caixa com 200 unidade
Descrição: Material de Consumo
5Caixa


6081/2021
10/03/2021 16:00:00
Dispensa de licitação
258/2021 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: vacina contra raiva em bovinos
Descrição: Compra de 14 frascos de 50 ml cada frasco de Raivacel vacina contra raiva em bovinos. Composição: Vírus fixo Pasteur inativado pelo BEI e produzido em cultivo celular. Indicação: Profilaxia da raiva dos bovinos, ovinos, caprinos e equinos.
14Frasco


6119/2021
13/03/2021 16:00:00
Dispensa de licitação
259/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Pissetas bico curvo
Descrição: Pisseta de bico curvo 500ml com graduação.
5Unidade


6193/2021
12/03/2021 16:00:00
Dispensa de licitação
260/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: cloreto benzalcônico 50%
Descrição: Cloreto benzalcônico 50 %
12Litro


6260/2021
13/03/2021 16:00:00
Dispensa de licitação
261/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Parafuso Cortical Ø1,5 comp 06 a 20mm (2 em 2) 1 de cada
Descrição: Parafuso Cortical Ø1,5 comp 06 a 20mm (2 em 2) 1 de cada. * MATERIAL TITÂNIO
8Unidade
Produto/Serviço: Parafuso Cortical Ø2,0, comp 06 a 20mm (2 em 2) 1 de cada
Descrição: Parafuso Cortical Ø2,0, comp 06 a 20mm (2 em 2) 1 de cada * MATERIAL TITÂNIO
8Unidade
Produto/Serviço: Parafuso Bloqueado Ø1,5 comp 06 a 20mm (2 em 2) 5 de cada
Descrição: Parafuso Bloqueado Ø1,5 comp 06 a 20mm (2 em 2) 5 de cada * MATERIAL TITÂNIO
40Unidade
Produto/Serviço: Parafuso Bloqueado Ø2,0 comp 06 a 20mm (2 em 2) 5 de cada
Descrição: Parafuso Bloqueado Ø2,0 comp 06 a 20mm (2 em 2) 5 de cada * MATERIAL TITÂNIO
40Unidade
Produto/Serviço: Placa 1,5/2,0 reta 04 furos
Descrição: Placa 1,5/2,0 reta 04 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 reta 05 furos
Descrição: Placa 1,5/2,0 reta 05 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 reta 06 furos
Descrição: Placa 1,5/2,0 reta 06 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 reta 07 furos
Descrição: Placa 1,5/2,0 reta 07 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 reta 08 furos
Descrição: Placa 1,5/2,0 reta 08 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 reta reforçada 10 furos
Descrição: Placa 1,5/2,0 reta reforçada 10 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 reta reforçada 12 furos
Descrição: Placa 1,5/2,0 reta reforçada 12 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 ponte 50mm
Descrição: Placa 1,5/2,0 ponte 50mm * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 ponte reforçada 66mm
Descrição: Placa 1,5/2,0 ponte reforçada 66mm * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 ponte reforçada 83mm
Descrição: Placa 1,5/2,0 ponte reforçada 83mm * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 ponte reforçada 98mm
Descrição: Placa 1,5/2,0 ponte reforçada 98mm * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 T 03 furos
Descrição: Placa 1,5/2,0 T 03 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 T 04 furos
Descrição: Placa 1,5/2,0 T 04 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 T 05 furos
Descrição: Placa 1,5/2,0 T 05 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 T 06 furos
Descrição: Placa 1,5/2,0 T 06 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 T 07 furos
Descrição: Placa 1,5/2,0 T 07 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 Y em ponte 02 furos
Descrição: Placa 1,5/2,0 Y em ponte 02 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 Y em ponte 03 furos
Descrição: Placa 1,5/2,0 Y em ponte 03 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 Y em ponte 04 furos
Descrição: Placa 1,5/2,0 Y em ponte 04 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 Y em ponte 05 furos
Descrição: Placa 1,5/2,0 Y em ponte 05 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 Y em ponte 06 furos
Descrição: Placa 1,5/2,0 Y em ponte 06 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 L Direita 05 furos
Descrição: Placa 1,5/2,0 L Direita 05 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 L Esquerda 05 furos
Descrição: Placa 1,5/2,0 L Esquerda 05 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 Condilar Direita 05 furos
Descrição: Placa 1,5/2,0 Condilar Direita 05 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 Condilar Esquerda 05 furos
Descrição: Placa 1,5/2,0 Condilar Esquerda 05 furos * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 TPLO L 90° Direita
Descrição: Placa 1,5/2,0 TPLO L 90° Direita * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 TPLO L 90° Esquerda
Descrição: Placa 1,5/2,0 TPLO L 90° Esquerda * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 TPLO Y
Descrição: Placa 1,5/2,0 TPLO Y * MATERIAL TITÂNIO
1Unidade
Produto/Serviço: Placa 1,5/2,0 TPLO Y Longa
Descrição: Placa 1,5/2,0 TPLO Y Longa * MATERIAL TITÂNIO
1Unidade


6263/2021
13/03/2021 16:00:00
Dispensa de licitação
262/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AGULHA 20 X 5,5 - CAIXA COM 100 UNIDADE
Descrição: AGULHA 20 X 5,5 - agulha, hipodérmica, 20 X 5,5, corpo em aço inox siliconizado, bisel curto trifacetado, conector em plástico luer, protetor plástico, estéril, descartável. embalagem unitária contendo número do lote; data de fabricação e data de validade. registro na anvisa/ms. validade de no mínimo 1 ano.
2Caixa
Produto/Serviço: AGULHA 40 X 12 - CAIXA COM 100 UNIDADE
Descrição: AGULHA 40 X 12 - CAIXA COM 100 UNIDADE. Agulha hipodérmica descartável, para punção, cânula em aço inoxidável, canhão de material plástico atóxico ou liga de alumínio em cores de acordo com o padrão, de codificação de calibre, bisel trifacetado, siliconizado em superfície externa , atraumática, estéril, aprirogênico e atóxico com tampa plástica protetora n° 40x12, embalagem unitária contendo número do lote, data de fabricação e data de validade, registro na anvisa. validade mínima de um ano na data da entrega.
30Caixa
Produto/Serviço: ÁGUA OXIGENADA 10 VOLUMES COM 1000ML
Descrição: ÁGUA OXIGENADA 10 VOLUMES COM 1000ML REGISTRO ANVISA/MS. NOME DO RESPONSÁVEL TÉCNICO. PRAZO DE VALIDADE DE NO MÍNIMO 75% DA ESPECIFICADA NO RÓTULO. Data de validade no mínimo de um ano na data de validade na data da entrega. ENTREGA A PROGRAMAR
12Frasco
Produto/Serviço: CATETER INTRAVENOSO INSYTE 22GA X 1''
Descrição: CATETER INTRAVENOSO INSYTE 22GA X 1.00" cateter intravenoso radiopaco estéril, 22GA X 1.00'' 0,9 x 25mm, 25mL/min, para terapia intravenosa periférica. Esterilizado por óxido de etileno. Embalagem individual conforme legislação vigente, registro no M.S. ANVISA, contendo especificação do produto, fabricante, número de lote, data de fabricação, prazo de validade, SAC padronização de cores de acordo com NBR ISSO10555-5.
600Unidade
Produto/Serviço: CLOREXIDINA SOLUÇÃO ALCOOLICA 0,5%, FRASCO 1L
Descrição: CLOREXIDINA SOLUÇÃO ALCOOLICA 0,5% FRASCO 1L - Solução alcóolica contendo 0,5% de digliconato de clorexidina. Validade de no mínimo 1 ano. Embalagem contendo lote, data de fabricação, prazo de validade
24Unidade
Produto/Serviço: CLOREXIDINA SOLUÇÃO AQUOSA 2,0%, DEGERMANTE, FRASCO 100ML ALMOTOLIA
Descrição: CLOREXIDINA SOLUÇÃO AQUOSA 2,0% DEGERMANTE, ALMOTOLIAFRASCO 100ML - Solução alcóolica contendo 2,0% de digliconato de clorexidina. Validade de no mínimo 1 ano. Embalagem contendo lote, data de fabricação, prazo de validade. ENTREGA A PROGRAMAR
360Unidade
Produto/Serviço: CLOREXIDINA SOLUÇÃO AQUOSA 2,0%, DEGERMANTE, FRASCO 1L
Descrição: CLOREXIDINA SOLUÇÃO AQUOSA 2,0%, DEGERMANTE, FRASCO 1L REGISTRO ANVISA. VALIDADE MÍNIMA DE 1 ANO.
24Unidade


6264/2021
12/03/2021 16:00:00
Dispensa de licitação
263/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: BANDAGEM ATADURA ELÁSTICA CO-ADESIVA 10 CM X 4,5M
Descrição: ATADURA CO-ADESIVA 10CM X 4,5M - atadura elástica e co-adesiva, sem látex, resistente a água e não aderente a pelagem do animal. Compressão controlada e livre ventilação da área tratada. Enrolada uniformemente de forma cilíndrica, em embalagem individual e isenta de defeito. Pode ser entregue em qualquer cor.
50Unidade


6271/2021
13/03/2021 16:00:00
Dispensa de licitação
264/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: TRAMADOL, CLORIDRATO 50 MG/ML - SOLUÇÃO INJETÁVEL AMPOLA C/ 2 ML
Descrição: TRAMADOL, CLORIDRATO 50 MG/ML - SOLUÇÃO INJETÁVEL AMPOLA C/ 2 ML. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO.
500Ampola
Produto/Serviço: Acetilcisteína 100mg/mL, solução injetável ampolas 3mL
Descrição: Acetilcisteína 100mg/mL, solução injetável ampolas 3mL. Caixa com 5 ampolas. Registro na ANVISA, responsável Técnico. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO.
20Ampola
Produto/Serviço: AMOXICILINA 1000MG + ACIDO CLAVULÂNICO 200MG - PÓ INJETÁVEL FRC
Descrição: AMOXICILINA 1000MG + ÁCIDO CLAVULÂNICO 200MG - PÓ INJETÁVEL ) Validade de no mínimo 1 ano no momento da entrega na farmácia. Medicamento com registro na ANVISA
200Frasco
Produto/Serviço: MORFINA, SULFATO 10 MG/ML - SOLUÇÃO INJETÁVEL AMPOLA C/1 ML.
Descrição: MORFINA, SULFATO 10 MG/ML - SOLUÇÃO INJETÁVEL AMPOLA C/1 ML. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO.
200Ampola
Produto/Serviço: VINCRISTINA, SULFATO 1MG/ML FRASCO-AMPOLA C/ 1ML, CAIXA COM 5 UNIDADES
Descrição: VINCRISTINA, SULFATO 1MG/ML FRASCOAMPOLA C/ 1ML, CAIXA COM 5 UNIDADES.RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO.
20Frasco
Produto/Serviço: HEPARINA SÓDICA 5000UI/ML FRASCO-AMPOLA COM 5 ML
Descrição: HEPARINA SÓDICA 5000UI/ML FRASCO-AMPOLA COM 5 ML - SOLUÇÃO INJETÁVEL. CAIXA COM 25 FRASCOSAMPOLA. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NO MOMENTO DA ENTREGA
25Unidade


6273/2021
13/03/2021 16:00:00
Dispensa de licitação
265/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FIO P/ SUTURA CAPROFYL 0 - CÓDIGO CF924T
Descrição: FIO PARA SUTURA - Fio de sutura de poliglecaprone 25, tamanho 0, comprimento do fio 90 cm; formato da agulha 1/2 círculo ,comprimento da agulha 36,4 mm. (CAPROFYL).
168Unidade


6306/2021
12/03/2021 16:00:00
Dispensa de licitação
266/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: TIOPENTAL 1 G - PÓ LIOFILIZADO
Descrição: TIOPENTAL 1 G - PÓ LIOFILIZADO. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO
75Frasco


6307/2021
13/03/2021 16:00:00
Dispensa de licitação
267/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: EXTENSOR 20 CM, COM LUER LOCK E COM CONTROLADOR DE FLUXO TIPO PINÇA (CLAMP)
Descrição: Extensor 20 cm com controlador de fluxo tipo pinça (clamp) em pvc com conector luer fêmea e luer lock reversível transparentes, com pega não inferior a 1,5 cm. Estéril, apirogênico, atóxico, embalado individualmente em papel grau cirúrgico ou filme termoplástico contendo os dados impressos de identificação, lote, data de fabricação e validade e registro Anvisa/MS. SÓ ATENDE DA MARCA MEDSONDA COM CLAMP
500Unidade
Produto/Serviço: EXTENSOR 60 CM, COM LUER LOCK E COM CONTROLADOR DE FLUXO TIPO PINÇA (CLAMP)
Descrição: Extensor 60 cm com controlador de fluxo tipo pinça (clamp) em pvc com conector luer fêmea e luer lock reversível transparentes, com pega não inferior a 1,5 cm. Estéril, apirogênico, atóxico, embalado individualmente em papel grau cirúrgico ou filme termoplástico contendo os dados impressos de identificação, lote, data de fabricação e validade e registro Anvisa/MS. VALIDADE DE NO MÍNIMO UM ANO NA DATA DA ENTREGA
100Unidade
Produto/Serviço: EXTENSOR 120 CM, COM LUER LOCK E COM CONTROLADOR DE FLUXO TIPO PINÇA (CLAMP)
Descrição: : Extensor 120 cm com controlador de fluxo tipo pinça (clamp) em pvc com conector luer fêmea e luer lock reversível transparentes, com pega não inferior a 1,5 cm. Estéril, apirogênico, atóxico, embalado individualmente em papel grau cirúrgico ou filme termoplástico contendo os dados impressos de identificação, lote, data de fabricação e validade e registro Anvisa/MS. VALIDADE DE NO MÍNIMO UM ANO NA DATA DA ENTREGA.
100Unidade


6308/2021
13/03/2021 16:00:00
Dispensa de licitação
268/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: EQUIPO MICROGOTAS COM INJETOR LATERAL COM FILTRO DE PARTÍCULAS DE 15 MICRAS
Descrição: EQUIPO MICROGOTAS COM INJETOR LATERAL COM FILTRO DE PARTÍCULAS DE 15 MICRAS - equipo microgotas com injetor lateral com membrana auto-cicatrizante látex free, ponta perfurante tipo universal, entrada de ar com filtro de 0,22µm, câmara de gotejamento flexível e transparente com padrão micro gotas, tubo flexível de coloração azul em pvc, filtro de partículas de 15 µm, tubo em pvc transparente de no mínimo 1,20m de comprimento, regulador de fluxo tipo pinça rolete, conector luer macho universal com protetor. Embalado individualmente em papel grau cirúrgico e filme termoplástico, contendo os dados impressos de identificação, lote, data de fabricação e validade e registro anvisa. Produto deve atender a ABNT-NBR 8536-4/2011. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA. DIVIDIR ENTREGA EM 2X
200Unidade
Produto/Serviço: EQUIPO MACROGOTAS COM INJETOR LATERAL E FILTRO DE PARTÍCULA DE 15 MICRAS
Descrição: EQUIPO MACROGOTAS COM INJETOR LATERAL E FILTRO DE PARTÍCULA DE 15 MICRAS - equipo de infusão gravitacional estéril e de uso único, macrogotas com injetor lateral com membrana auto-cicatrizante látex free, ponta perfurante tipo universal com tampa, entrada de ar com filtro de 0,22µm, câmara de gotejamento flexível e transparente com padrão macro gotas (20 gotas/ minuto), filtro de partículas de 15 µm, tubo em pvc transparente de no mínimo 1,20m de comprimento, regulador de fluxo tipo pinça rolete, conector LUER LOCK universal com protetor. Embalado individualmente em papel grau cirúrgico e filme termoplástico, contendo os dados impressos de identificação, lote, data de fabricação e validade e registro anvisa. Produto deve atender a ABNT-NBR 8536-4/2011. DIVIDIR ENTREGA EM 2X
800Caixa


6309/2021
12/03/2021 16:00:00
Dispensa de licitação
269/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FIO P/ SUTURA CAPROFYL 3-0 - CF810T
Descrição: Fio de sutura de poliglecaprone 25, tamanho 3-0, comprimento do fio 70 cm; formato da agulha 1/2 círculo, comprimento da agulha 36,4 mm. (CAPROFYL).
288Unidade
Produto/Serviço: FIO P/ SUTURA CAT GUT CROMADO 1 - 813T
Descrição: FIO P/ SUTURA CAT GUT CROMADO 1 - 813T (COLÁGENO) diâmetro 1, de 70cm, encastoado a uma agulha de 36,4mm, com curvatura de 1/2 círculo cilíndrica.
24Unidade


6310/2021
13/03/2021 16:00:00
Dispensa de licitação
270/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ANTICORPO MONOCLONAL (mAb) CONTRA INTERLEUCINA 31 (IL-31) Cytopoint 20mg
Descrição: Anticorpo monoclonal (mAb) caninizado que actua especificamente neutralizando a interleucina 31 (IL-31)- Cytopoint 20mg. Data de validade no mínimo de 75% do total na data de entrega do produto.
10Dose


6311/2021
13/03/2021 16:00:00
Dispensa de licitação
271/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Biombo Plumbífero Reto Sem Visor 0,80 X 1,80 (2mm)
Descrição: Biombo Plumbífero Reto Sem Visor 0,80 X 1,80 2mm
1Unidade
Produto/Serviço: Biombo Plumbífero Reto com Visor 0,80 X 1,80 (2mm)
Descrição: Biombo Plumbífero Reto com Visor 0,80 X 1,80 (2mm)
1Unidade


6314/2021
12/03/2021 16:00:00
Dispensa de licitação
272/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SUPORTE PARA COLETOR (13LITROS)
Descrição: SUPORTE PARA COLETOR (13LITROS) Composição: Fabricado em Arame BTC. Diferenciais e benefícios - Cor Branca; - Os suportes para coletores perfuros cortantes são desenvolvidos no tamanho adequado para sua precisão; - Pode ser usado sob uma bancada ou fixado na parede; - Para maior facilidade no uso, mantenha o suporte fixado a uma distância de, no mínimo, 1,20m do chão. Itens inclusos 01 Suporte para Coletor de Papelão tamanho 13 litros DESCARPACK. 02 Parafusos; 02 Buchas. Altura do produto (cm) 22,50 Largura do produto (cm) 29,00 Profundidade do produto (cm) 24,00 Peso líquido (Kg) 0,260 Altura da embalagem (cm) 22,50 Largura da embalagem (cm) 29,00 Profundidade da embalagem (cm) 24,00 Peso bruto com embalagem (Kg) 0,260
19Unidade


6316/2021
13/03/2021 16:00:00
Dispensa de licitação
273/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: TRIANCINOLONA 20MG/ML - AMPOLA C/ 1ML
Descrição: TRIANCINOLONA 20MG/ML - AMPOLA C/ 1ML MEDICAMENTO COM REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA NA FARMÁCIA
20Unidade


6324/2021
13/03/2021 16:00:00
Dispensa de licitação
274/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AgraQuant Fumonisina (250-5000 ppb) - 96 poços
Descrição: AgraQuant Fumonisina (250-5000 ppb) - 96 poços Validade: no mínimo 6 meses a contar da data de entrega do material.
1Kit
Produto/Serviço: AgraQuant Ocratoxina (2-40 ppb) - 96 poços
Descrição: AgraQuant Ocratoxina (2-40 ppb) - 96 poços Validade: no mínimo 6 meses a contar da data de entrega do material.
1Kit
Produto/Serviço: AgraQuant T2-Toxina (20-500 ppb) - 96 poços
Descrição: AgraQuant T2-Toxina (20-500 ppb) - 96 poços Validade: no mínimo 6 meses a contar da data de entrega do material.
1Kit
Produto/Serviço: AgraQuant Zearalenone (40-1000 ppb) - 96 poços
Descrição: AgraQuant Zearalenone (40-1000 ppb) - 96 poços Validade: no mínimo 6 meses a contar da data de entrega do material.
1Kit


6400/2021
12/03/2021 16:00:00
Dispensa de licitação
275/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Oligonucleotideo ITSLg30F Dang et al 2012, Escala 25 nmol
Descrição: Oligonucleotideo ITSLg30F Dang et al 2012 Sequencia 5`- 3` ACTTTATTCAGTTTTGAGGGGTCT Escala 25 nmol
1Unidade
Produto/Serviço: Oligonucleotideo ITSLg319R Dang et al 2012, Escala 25 nmol
Descrição: Oligonucleotideo ITSLg319R Dang et al 2012 Sequencia 5`- 3` TTTAAAAGAATTCGCAGCTTTACA Escala 25 nmol
1Unidade
Produto/Serviço: Qubit Assay Tubes, Thermo Scientific ref. Q3256, pacote com 500 tubos
Descrição: oligonucleotídeos
2Pacote


6412/2021
13/03/2021 16:00:00
Dispensa de licitação
276/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: formol 37% estabilizado
Descrição: Compra de 02 galões de Formol 37% estabilizado de 50 litros. Setor de bovinos de leite.
2Galão


6413/2021
13/03/2021 16:00:00
Dispensa de licitação
277/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Hipoclorito de sodio 10-12%
Descrição: Compra de 2 galões de Hipoclorito de Sódio 10% de 50 litros cada galão. Total de 100 litros. Setor de bovinos de leite.
2Galão


6414/2021
13/03/2021 16:00:00
Dispensa de licitação
278/2021 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: placa petri estéril descartável
Descrição: Placa de Petri 60x15mm descartável estéril, lisa, caixa c/500 unidades
1Caixa
Produto/Serviço: lâmina para microscópio lisa
Descrição: Lâmina Para Microscopia 26 X 76 mm, 50 und./pct.
6Caixa
Produto/Serviço: lamínulas para microscópio
Descrição: Lamínula 24 x 24 mm 1000 und./pct.
3Caixa
Produto/Serviço: Criotubo
Descrição: Tubo Criogênico (criotubo) 2,0 ml Rosca Externa 100 und.
1Pacote
Produto/Serviço: lamina bisturi n.24 solidor c/100
Descrição: Lâmina de Bisturi n 24
1Caixa
Produto/Serviço: Luva simples
Descrição: Luva Látex Branca Com Pó Tamanho P 100 Unidades
4Caixa
Produto/Serviço: corante panótico
Descrição: Kit Coloração Panótico Rápido
1Kit
Produto/Serviço: corante
Descrição: Corante Lactofenol azul de algodão - Frasco 100 ML
1Frasco


6430/2021
13/03/2021 16:00:00
Dispensa de licitação
279/2021 Equipamentos/Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: MacBook Air 13" Apple Intel Core i5 8GB RAM 128GB SSD Prateado
Descrição: MacBook Air 13" Apple Intel Core i5 8GB RAM 128GB SSD Prateado
1Unidade