ÁREA DO FORNECEDOR

ACESSO RESTRITO












Destaques


A FEPE recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
5828/2022
30/05/2022 16:00:00
Dispensa de licitação
275/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Equipamentos
Descrição: Destilador de nitrogênio
1Unidade


8225/2022
27/05/2022 17:00:00
Dispensa de licitação
404/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ALFAINTERFERONA 3.000.000 UI 2B - CAIXA COM 5 FRASCOS-AMPOLA DE 1ML
Descrição: ALFAINTERFERONA 3.000.000 UI 2B - CAIXA COM 5 FRASCOS-AMPOLA DE 1ML. REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO NA ENTREGA NA FARMÁCIA
5Unidade


11564/2022
27/05/2022 18:00:00
Dispensa de licitação
575/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SONDA URETRAL FLEXÍVEL DE ESPERA (CATETER) - tamanho 3.5 Fr/Ch
Descrição: Na cor vermelha, entrada em funil, dois olhos, ponta arredondada fechada. Com a temperatura do corpo torna-se mais macia, elástica, flexível. Livre de látex. Medida: 1,2mm x 41cm. Tamanho: 3.5 Fr/Ch 1.7mm x 16" (41cm)
10Unidade


12920/2022
27/05/2022 19:00:00
Dispensa de licitação
628/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SULFAMETOXAZOL 10G/50ML+ TRIMETROPRIMA 2G/50ML SOLUÇÃO INJETÁVEL - FRASCO 50ML
Descrição: FAVOR NÃO COTAR SULFA DIFERENTE DA ESPECIFICADA! SULFAMETOXAZOL 10G/50ML+ TRIMETROPRIMA 2G/50ML SOLUÇÃO INJETÁVEL - FRASCO 50ML INDICADO PARA USO EM PEQUENOS ANIMAIS. MEDICAMENTO COM REGISTRO NO MAPA. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA NA FARMÁCIA.
5Frasco


13970/2022
30/05/2022 16:00:00
Dispensa de licitação
696/2022 Contratação de Outros Serviços
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Serviço de Correio - Documentos para exterior
Descrição: Envio de documentos para Leiden, Holanda. Endereço: LUMC - Medical Microbiology. Albinusdreef 2, room L4-12B. Leiden, The Netherlands. Postal Code 2333.
1Unidade


14179/2022
31/05/2022 16:00:00
Importação
6/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Actígrafo com carregador
Descrição: Actígrafo ActTrust 2 (Marca Condor) com carregador
20Unidade


14181/2022
31/05/2022 16:00:00
Importação
4/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Rádio Gravador de dados TEMPERATURA CENTRAL
Descrição: Rádio Gravador de dados - CorTemp® EliteTM Data Recorder
1Unidade
Produto/Serviço: Pílula de telemetria
Descrição: Pílula de telemetria HQI NCM
20Unidade


14735/2022
27/05/2022 18:00:00
Dispensa de licitação
728/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CICLOFOSFAMIDA 200 MG PÓ P/ SOLUÇÃO INJETÁVEL
Descrição: CICLOFOSFAMIDA 200 MG PÓ P/ SOLUÇÃO INJETÁVEL MEDICAMENTO COM REGISTRO NA ANVISA. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA
10Unidade


15676/2022
27/05/2022 19:00:00
Dispensa de licitação
783/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Alicate
Descrição: 01 Alicate Ricardinho ente 25 a 30cm de comprimento e com capacidade de Corte Inox ate 6mm- Titânio 4mm
1Unidade
Produto/Serviço: Cureta Meyehoefer
Descrição: 01 Cureta Meyehoefer de 1mm com o cabo entre 12 e 15 cm de comprimento.
1Unidade


16458/2022
27/05/2022 19:00:00
Dispensa de licitação
802/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CLOTRIMAZOL (1G)+GENTAMICINA (0,846G) +BETAMETASONA (0,151G)+BENZOCAÍNA(2,0G)- SUSPENSÃO OTOLÓGICA - FRASCO 50ML.
Descrição: CLOTRIMAZOL (1G)+GENTAMICINA (0,846G) +BETAMETASONA (0,151G)+BENZOCAÍNA(2,0G)- SUSPENSÃO OTOLÓGICA - FRASCO 50ML. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA MAPA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO
5Frasco


16486/2022
27/05/2022 18:00:00
Dispensa de licitação
808/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: VALERATO DE BETAMETASONA 1mg/g POMADA DE 30g.
Descrição: VALERATO DE BETAMETASONA 1mg/g POMADA DE 30g. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 1 ANO
20Bisnaga
Produto/Serviço: SIMETICONA 75MG/ML, GOTAS, EMULSÃO ORAL - FRASCO COM 15ML
Descrição: SIMETICONA 75MG/ML, GOTAS, EMULSÃO ORAL - FRASCO COM 15ML. MEDICAMENTO GENÉRICO. MEDICAMENTO COM REGISTRO NA ANVISA. PRAZO DE VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA NA FARMÁCIA.
50Frasco


16646/2022
30/06/2022 16:00:00
Processo Seletivo Simplificado
10/2022 Equipamentos/Produtos de Laboratório
EDITAL SELEÇÃO PÚBLICA Nº 004/2022 FEPE !
MODELO DE PROPOSTA DE PREÇO, EDITAL SELEÇÃO PÚBLICA 004_2022_FEPE !

Produto/ServiçoQuant.Unidade
Produto/Serviço: Incubadora de jaqueta d'água Water Jacket Series 3, com controle de CO2 e O2.
Descrição: Contratação de empresa (s) especializada em fornecimento de equipamento, com as especificações mínimas contidas no Termo de Referência – Anexo I.
1Unidade


16650/2022
31/05/2022 16:00:00
Importação
5/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: BiPRO GMP 9000 (glycomacropeptide) - 400 GRAMAS
Descrição: Material de Consumo
1Unidade


16723/2022
27/05/2022 19:00:00
Dispensa de licitação
825/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: oligonucleotídeos
Descrição: Oligonucleotídeo - para uso com adjuvante em embriões de galinhas. Características específicas: Sequência: GTCGTTGTCGTTGTCGTT - Desalt - Dry in tubes -Rendimento final: mínimo de 5,5 mg (miligramas) divididos em dois tubos.
1Frasco


17713/2022
31/05/2022 16:00:00
Processo Seletivo Simplificado
8/2022 Contratação de Outros Serviços
EDITAL 002/2022 - SELEÇÃO SIMPLIFICADA BOLSISTA PESQUISA, GRADUAÇÃO !
RESULTADO PROCESSO SELEÇÃO SIMPLIFICADA, BOLSISTA !

Produto/ServiçoQuant.Unidade
Produto/Serviço: PROCESSO SELETIVO SIMPLIFICADO
Descrição: ABERTURA DE PROCESSO SELETIVO SIMPLIFICADO PARA BOLSA DE PESQUISA 01 vaga- Bolsista da Psicologia (Bacharelado). As inscrições serão realizadas no período de 06/05/2022 até as 18 horas de 10/05/2022, para o e-mail (esporteparalimpicoufmg@gmail.com), Assunto – Processo Seletivo Bolsista Psicologia. i) uma cópia de seu comprovante de matrícula regular ii) currículo vitae;
1Unidade


18094/2022
30/05/2022 16:00:00
Dispensa de licitação
867/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: fonte
Descrição: Fonte para Monitor 100-240 VAC/ 15VDC/ 2A Obs.: Compatível com Monitor Bionet Bm5
1Unidade
Produto/Serviço: Cabo
Descrição: Cabo tronco para ECG modelo Rabicho 3 vias Obs.: Compatível com Monitor Bionet Bm5
1Unidade
Produto/Serviço: Cabo
Descrição: Cabo tronco para ECG modelo Rabicho 5 vias Obs.: Compatível com Monitor Bionet Bm5
1Unidade
Produto/Serviço: Cabo
Descrição: Cabo de oxímetro com sensor tipo multisite ou "Y'' Obs.: Compatível com Monitor Bionet Bm5
1Unidade
Produto/Serviço: Cabo
Descrição: Cabo para ECG modelo Rabicho 3 vias Obs.: Compatível com Monitores Laslo e Digicare
1Unidade
Produto/Serviço: Cabo
Descrição: Cabo de temperatura com sensor esofágico /retal com conector tipo ''p10'' Obs.: Compatível com Monitores Laslo e Digicare
4Unidade
Produto/Serviço: Cabo
Descrição: Cabo de temperatura com sensor de superfícies com conector tipo ''p10'' Obs.: Compatível com Monitores Laslo e Digicare
4Unidade


18100/2022
27/05/2022 19:00:00
Dispensa de licitação
872/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: LOMUSTINA 6MG, CÁPSULA (MEDICAMENTO MANIPULADO)
Descrição: LOMUSTINA 6MG, CÁPSULA REGISTRO MS/ANVISA VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE DO PRODUTO SUGESTÃO DE MARCA: CITOSTAL
20Comprimido
Produto/Serviço: LOMUSTINA 9 MG, CÁPSULA (MEDICAMENTO MANIPULADO)
Descrição: LOMUSTINA 9MG, CÁPSULA. REGISTRO MS/ANVISA VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE DO PRODUTO. SUGESTÃO DE MARCA: CITOSTAL
20Comprimido
Produto/Serviço: LOMUSTINA 3MG, CÁPSULA (MEDICAMENTO MANIPULADO)
Descrição: LOMUSTINA 3MG, CÁPSULA - MEDICAMENTO MANIPULADO VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE DO MEDICAMENTO
20Comprimido


18943/2022
30/05/2022 13:00:00
Dispensa de licitação
890/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: COMPRESSA CIRÚRGICA, CAMPO OPERATÓRIO 45X50, DESCARTÁVEL, ESTÉRIL, PACOTE COM 2 UNIDADES
Descrição: COMPRESSA CIRÚRGICA, CAMPO OPERATÓRIO 45X50, DESCARTÁVEL, ESTÉRIL, PACOTE COM 2 UNIDADES ATENÇÃO: PACOTE COM 2 UNIDADES!!!
600Pacote


18962/2022
30/05/2022 18:00:00
Dispensa de licitação
908/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SERINGA PARA GASOMETRIA PRESET LUER LOK 3 mL (COM AGULHA ECLIPSE)
Descrição: SERINGA PARA GASOMETRIA PRESET LUER LOK 3 mL (COM AGULHA ECLIPSE) ±Kit esterilizado a Radiação gama, contendo seringa em prolipropileno de alta densidade, livre de látex, transparente, graduada em 3,0mL (volume de aspiração 1,6mL de acordo com o IFCC), siliconizada, com bico luer-lok. Possui membrana porosa interna auto-vedante. ÊMBOLO NA COR VERDE CLARA. Contém 80 U.I. de Heparina de Lítio derivada da mucosa intestinal do porco, jateada spray seco, para coleta de sangue na análise de gasometria e eletrólitos. Permite três modos de coleta: natural, pré-calibrado ou por aspiração. Acompanha: agulha 25x7 (22G1) em aço inoxidável com bisel trifacetado, siliconizada, canhão incolor com dispositivo exclusivo de segurança na cor rosa, que após o uso deverá ser acionado recobrindo completamente a agulha garantindo total biosegurança. Tampa Hemogard na cor verde de acordo com a ISO 6710, adaptável ao bico da seringa, para vedação de ar e CE Marked. Embalagem unitária em plástico transparente, livre de látex, com picote para abertura, contendo: nº de catálogo, nº de lote, descrição do conteúdo e informações de segurança sobre o produto. Apresentação: Caixa com 100 unidades.
100Unidade


19062/2022
31/05/2022 15:00:00
Dispensa de licitação
917/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Rifamicina spray 10mg/mL - frasco de 20mL
Descrição: Rifamicina spray 10mg/mL - frasco de 20mL Registro na ANVISA. Validade de no mínimo 1 ano no momento da entrega na farmácia.
20Frasco


19296/2022
30/05/2022 16:00:00
Dispensa de licitação
921/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: POP-7 polymer
Descrição: POP-7™ Polymer, - ABI -500 - 960 amostras
1Unidade


19298/2022
27/05/2022 20:00:00
Dispensa de licitação
923/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: carrapaticida SUPOKKIL
Descrição: Compra de 2 frasco de 1 litro de Supokill Carrapaticida (UcbVet). Carrapaticida seletivo no controle de carrapatos de bovinos e equinos. Elimina tanto as larvas como impossibilita a postura de ovos férteis.
2Frasco


19342/2022
27/05/2022 19:00:00
Dispensa de licitação
928/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CICLOFOSFAMIDA 50MG DRÁGEA
Descrição: CICLOFOSFAMIDA 50MG DRÁGEA. MEDICAMENTO COM REGISTRO NA ANVISA. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA
50Comprimido
Produto/Serviço: ISOFLURANO ISOFLURANO 1 MG/ML - C/ 100 ML - SOLUÇÃO INJETÁVEL
Descrição: ISOFLURANO 1 MG/ML - C/ 100 ML - SOLUÇÃO INJETÁVEL LABORATÓRIO CRISTÁLIA PRAZO DE VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA
25Frasco


19462/2022
27/05/2022 18:00:00
Dispensa de licitação
931/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Soro Ringer com Lactato 250mL Bolsa Sistema Fechado
Descrição: Soro Ringer com Lactato 250mL Bolsa Sistema Fechado Fabricante: JP Farma ou similar
10Unidade
Produto/Serviço: Equipo macrogotas Luer Slip completo
Descrição: Equipo de infusão gravitacional macrogotas com conector Luer Slip Fabricante: Medix ou similar
10Unidade
Produto/Serviço: Scalp 19 G
Descrição: Scalp Descartável 19G Fabricante: Solidor, Descarpack ou similar
10Unidade


19581/2022
27/05/2022 18:00:00
Dispensa de licitação
934/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ERITROPOETINA 400MG, PÓ LIÓFILO, FRASCO-AMPOLA
Descrição: ERITROPOETINA 400MG, PÓ LIÓFILO, FRASCO-AMPOLA MEDICAMENTO COM REGISTRO NA ANVISA. PRAZO DE VALIDADE SUPERIOR A UM ANO NA DATA DA ENTREGA
10Unidade


19665/2022
27/05/2022 19:00:00
Dispensa de licitação
937/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Oligonucleotideo LG-ITS-qF Shahin et al 2021
Descrição: Oligonucleotideo LG-ITS-qF Shahin et al 2021 Sequencia 5'-3' CAA GAT AGA GAA GAT TGC GTT GAG Escala:25 nmol
1Unidade
Produto/Serviço: Oligonucleotideo LG-ITS-qR Shahin et al 2021
Descrição: Oligonucleotideo LG-ITS-qR Shahin et al 2021 Sequencia 5'-3' CCG TAT CTT ATG GAG CCT AGC Escala:25 nmol
1Unidade
Produto/Serviço: Oligonucleotideo LG-ITS-probe Shahin et al 2021
Descrição: Oligonucleotideo LG-ITS-probe Shahin et al 2021 Sequencia 5'-3' FAM-TGC TTT GCA CGC AGG AGG TCA-BHQ1 Escala:10 nmol
1Unidade
Produto/Serviço: Oligonucleotideo TiPV-VP205Probe Yamkasem et al 2021
Descrição: Oligonucleotideo TiPV-VP205Probe Yamkasem et al 2021 Sequencia 5'-3' FAM-CCAGTCCCGACCTACTCAAA- BHQ1 Escala:10 nmol
1Unidade
Produto/Serviço: Oligonucleotideo TiPV-VP205F Yamkasem et al 2021
Descrição: Oligonucleotideo TiPV-VP205F Yamkasem et al 2021 Sequencia 5'-3' CCAGATTGAAAGGGGCACGA Escala:25 nmol
1Unidade
Produto/Serviço: Oligonucleotideo TiPV-VP205R Yamkasem et al 2021
Descrição: Oligonucleotideo TiPV-VP205R Yamkasem et al 2021 Sequencia 5'-3' TTGGTGTTGGTGGTACGCAT Escala:25 nmol
1Unidade


19811/2022
27/05/2022 21:00:00
Dispensa de licitação
940/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: rolo embalagem para esterilização SMS 40G (Wnaps)
Descrição: Rolo de Embalagem Para Esterilização Autoclave 09cm X
4Rolo


19830/2022
29/05/2022 16:00:00
Dispensa de licitação
941/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Meio de Cultura L15 liquido estéril 500ml
Descrição: Leibovitz's L-15 Medium This L-15 is modified as follows: With Without • Galactose • Glucose • Phenol Red • HEPES • L-glutamine • Sodium Bicarbonate • Sodium Pyruvate
3Frasco
Produto/Serviço: Soro Equino estéril 500ml
Descrição: Soro equino para cultivo celular. Com L-glutamina, líquido, filtrado estéril, vermelho de fenol. Soro (negativo) testado por EIA de um rebanho de doadores
2Frasco
Produto/Serviço: Tripsina 5g
Descrição: Trypsin from porcine pancreas lyophilized powder, BioReagent, suitable for cell culture, 1,000-2,000 BAEE units/mg solid
1Frasco
Produto/Serviço: Anfotericina B
Descrição: A anfotericina B é um antifúngico, produzido pelo Streptomyces nodosus. Previne o crescimento de fungos, causando um aumento na permeabilidade da membrana plasmática dos fungos. Ele se liga ativamente aos esteróis e leva à formação de poros. É usado para prevenir a contaminação de culturas de células por leveduras e fungos multicelulares. Frasco com reagente líquido com 50ml. O frasco deve contém 250 µg de anfotericina B e 205 µg de desoxicolato de sódio por mL de água destilada. A concentração de trabalho recomendada varia de 0,25 a 2,50 µg/mL.
1Frasco
Produto/Serviço: Penicilina
Descrição: Penicilina sódica para cultivo celular 10MU
1Frasco
Produto/Serviço: Estreptomicina 25G
Descrição: Estreptomicina em pó para cultivo celular 25g
1Frasco
Produto/Serviço: Penicilina- Estreptomicina líquida
Descrição: Penicilina- Estreptomicina líquida estéril para cultivo celular
1Frasco


19991/2022
27/05/2022 19:00:00
Dispensa de licitação
943/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: BUTORFANOL, TARTARATO - 1% FRASCO C/ 10ML
Descrição: FAVOR COTAR O VOLUME IDÊNTICO! BUTORFANOL, TARTARATO - 10MG/ML FRASCO C/ 10ML. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOGE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, LICENCIADO NO MAPA. REGISTRO NO MAPA. VALIDADE DO PRODUTO DEVE SER NO MÍNIMO 1 ANO NA DATA DA ENTEGA NA INSTITUIÇÃO.
4Unidade


20100/2022
30/06/2022 16:00:00
Processo Seletivo Simplificado
9/2022 Contratação de Outros Serviços
SELECAO-SIMPLIFICADA-BOLSISTA-PESQUISA-GRADUACAO-CTE-2022-003

Produto/ServiçoQuant.Unidade
Produto/Serviço: PROCESSO SELETIVO SIMPLIFICADO
Descrição: ABERTURA DE PROCESSO SELETIVO SIMPLIFICADO PARA BOLSA DE PESQUISA 01 vaga- Bolsista da Educação Física (Bacharelado). As inscrições serão realizadas no período de 17/05/2022 até as 18 horas de 20/05/2022, para o e-mail (esporteparalimpicoufmg@gmail.com), Assunto – Processo Seletivo Bolsista Educação Física. i) uma cópia de seu comprovante de matrícula regular ii) currículo vitae;
1Unidade


20102/2022
31/05/2022 13:00:00
Dispensa de licitação
945/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Agencourte Ampure XP, 60 ml
Descrição: Reagente para análise de identificação de Microbiota, por NGS, realizada em parceria com a Prof. Roselene. Produtos exclusivos e específicos que precisam ser adquiridos em função do tipo de análise e compatível com equipamento de leitura. 60 ml
0,06Litro


20103/2022
30/05/2022 16:00:00
Dispensa de licitação
946/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Filtro Carvão ativado
Descrição: Filtro carvão ativado Grau de filtração - 5 Micras dimensões - 10" x 2,5" ( 10 polegadas de altura por 2,5 polegadas de diametro)
6Unidade


20218/2022
30/05/2022 16:00:00
Dispensa de licitação
950/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: kit de extração de DNA
Descrição: Maxwell® 16 Tissue DNA Purification Kit - AS1030
2Kit


20252/2022
30/05/2022 21:00:00
Dispensa de licitação
951/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: HIOSCINA,BUTILBROMETO 4MGML +DIPIRONA SOLUÇÃO INJETÁVEL, FRASCO-AMPOLA 50ML
Descrição: HIOSCINA,BUTILBROMETO 4MGML +DIPIRONA SOLUÇÃO INJETÁVEL, FRASCO-AMPOLA 50ML. Medicamento registrado no MAPA. Validade de no mínimo 1 ano na data da entrega.
12Frasco


20255/2022
30/05/2022 16:00:00
Dispensa de licitação
952/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ATROPINA, SULFATO 0,25 MG/ML - AMPOLA C/ 1 ML AMP -IV
Descrição: ATROPINA, SULFATO 0,25 MG/ML - AMPOLA C/ 1 ML AMP -IV . MEDICAMENTO COM REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA NA FARMÁCIA
100Ampola


20257/2022
30/05/2022 21:00:00
Dispensa de licitação
954/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CAMISA DE PROTEÇÃO PARA MICROCÂMERA ESTERILIZADA POR RAIOS GAMA, 13 CM X 250 CM
Descrição: CAMISA DE PROTEÇÃO PARA MICROCÂMERA ESTERILIZADA POR RAIOS GAMA, 13 CM X 250 CM. EMBALAGEM CONTENDO 1 UNIDADE. VALIDADE MAIOR QUE 1 ANO NA DATA DE ENTREGA NA FARMÁCIA.
50Unidade


20259/2022
30/05/2022 16:00:00
Dispensa de licitação
956/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SORO FISIOLÓGICO 0,9% FRASCO C/ 500ML
Descrição: SORO FISIOLÓGICO 0,9% SOLUÇÃO INJETÁVEL ESTÉRIL E APIROGÊNICA ACONDICIONADA EM FRASCO CONTENDO 500ML. EMBALAGEM UNITÁRIA CONTENDO NÚMERO DO LOTE; DATA DE FABRICAÇÃO E DATA DE VALIDADE. REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 01 ANO NO MOMENTO DA ENTREGA NA FARMÁCIA.
90Frasco


20262/2022
30/05/2022 16:00:00
Dispensa de licitação
958/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: placa
Descrição: PLACA RETA 1.5 X 6F
2Unidade
Produto/Serviço: parafuso
Descrição: PARAFUSO CORTICAL 1.5 X 08
5Unidade
Produto/Serviço: parafuso
Descrição: PARAFUSO BLOQUEiO 1.5 X 06
5Unidade
Produto/Serviço: placa
Descrição: PLACA T 1.5 X 2F
2Unidade
Produto/Serviço: placa
Descrição: PLACA Y 1.5 X 2F
2Unidade
Produto/Serviço: placa
Descrição: PLACA Y 1.5 X 3F
2Unidade
Produto/Serviço: parafuso
Descrição: PARAFUSO BLOQUEIO EMERG. 1.7 X 08
5Unidade


20263/2022
30/05/2022 16:00:00
Dispensa de licitação
959/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: cadeira giratória
Descrição: Cadeira Giratória Estofada, sem apoio de baços, base com regulagem de altura para o assento e para o encosto. Com inclinação para o encosto. Base em aço com capa de polipropileno na cor preta. Rodízios em poliuretano revestida em tecido preto. Medidas: - Encosto 42 cm largura X 39 cm altura. - Assento 46 cm largura X 46 cm de profundidade. * Cadeiras com certificado ABNT Solicita-se imagens nos orçamentos
4Unidade


20264/2022
30/05/2022 20:00:00
Dispensa de licitação
960/2022 Equipamentos/Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SSD WD Green 2.5'' 240GB SATA III 545 Mb/s WDS240G2G0A
Descrição: SSD WD Green 2.5'' 240GB SATA III 545 Mb/s WDS240G2G0A
10Unidade


20265/2022
31/05/2022 16:00:00
Dispensa de licitação
961/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FIO P/ SUTURA NYLON 3-0 - CÓDIGO 1171T
Descrição: Fio de sutura de nylon, tamanho 3-0, Comprimento do fio 45cm, formato da agulha 3/8 círculo, comprimento da agulha 30mm. (NYLON). Caixa com 24 unidades
240Unidade
Produto/Serviço: FIO P/ SUTURA NYLON 4-0 - CÓDIGO 1170T
Descrição: FIO DE NYLON 4-0 COM AGULHA DE 3/8 DE CÍRCULO, CILÍNDRICA, MEDINDO 3,5 CM. FIO CIRÚRGICO MONOFILAMENTO DE NYLON PRETO, ESTÉRIL, NÃO ABSORVÍVEL, DIÂMETRO 4-0, MEDINDO APROXIMADAMENTE 45CM, COM AGULHA DE 1/2 CÍRCULO, CILÍNDRICA, MEDINDO 2,4 CM, ESTÉRIL; EMBALAGEM INDIVIDUAL QUE PROMOVA BARREIRA MICROBIANA, ABERTURA ASSÉPTICA, INTEGRIDADE DO PRODUTO, CONFORME LEGISLAÇÃO VIGENTE - M.S. ANVISA - EM CONFORMIDADE COM NBR 13.904 DE MAIO DE 2003. INDICANDO O NÚMERO CIRÚRGICO, COMPRIMENTO DO FIO, TIPO DE SUTURA, TIPO DE AGULHA, TAMANHO DA AGULHA, NÚMERO DE FIOS (SE MÚLTIPLOS), FABRICANTE, LOTE, DATA DE FABRICAÇÃO E VALIDADE; REEMBALADO EM EMBALAGEM PRIMÁRIA DE FORMA A MANTER A INTEGRIDADE E ESTERILIZAÇÃO DO PRODUTO. VALIDADE DE NO MÍNIMO 01 ANO APÓS ENTREGA NA INSTITUIÇÃO. ENVELOPE. FORNECIMENTO DE AMOSTRA PARA AVALIAÇÃO TÉCNICA E FUNCIONAL ATRAVÉS DA REALIZAÇÃO DE ENSAIOS FUNCIONAIS (TESTES) PELOS PRINCIPAIS USUÁRIOS DURANTE A EXECUÇÃO DE SEUS PROCEDIMENTOS.
240Unidade
Produto/Serviço: FIO P/ SUTURA NYLON 2-0 - 1174T
Descrição: Fio de sutura de nylon, tamanho 2-0, Comprimento do fio 75 cm, formato da agulha 3/8 círculo, comprimento da agulha 40mm. (NYLON). Caixa com 24 unidad
240Unidade
Produto/Serviço: FIO P/ SUTURA CAPROFYL 2-0 -CÓDIGO CF923
Descrição: Fio de sutura de poliglecaprone 25, tamanho 2-0, comprimento do fio 90 cm; formato da agulha 1/2 círculo, comprimento da agulha 36 mm. (CAPROFYL). Caixa com 24 unidades
240Unidade
Produto/Serviço: FIO P/ SUTURA CAPROFYL 3-0 -CÓDIGO CF810
Descrição: Fio de sutura de poliglecaprone 25, tamanho 3-0, comprimento do fio 70 cm; formato da agulha 1/2 círculo, comprimento da agulha 36,4 mm. (CAPROFYL).
240Unidade
Produto/Serviço: FIO P/ SUTURA CAT GUT CROMADO 2-0 - CÓDIGO G164T
Descrição: FIO PARA SUTURA - Fio de sutura de catgut cromado (COLÁGENO), diâmetro 2-0, de 70 cm, encastoado a uma agulha de 31 mm, com curvatura de 1/2 círculo cilíndrica. Caixa com 24 unidades. Sugestão de Marca: Ethicon Código: G164T
96Unidade
Produto/Serviço: FIO P/ SUTURA CAT GUT CROMADO 3-0 - CÓDIGO G112
Descrição: FIO PARA SUTURA - Fio de sutura de catgut cromado (COLÁGENO), diâmetro 3-0, de 70 cm, encastoado a uma agulha de 31 mm, com curvatura de 3/8 círculo cilíndrica. Caixa com 24 unidade
96Unidade
Produto/Serviço: FIO P/ SUTURA CAT GUT CROMADO 4-0 - CÓDIGO G181T
Descrição: FIO PARA SUTURA - Fio de sutura de catgut cromado (COLÁGENO), diâmetro 4-0, de 70 cm, encastoado a uma agulha de 22 mm, com curvatura de 1/2 círculo cilíndrica. Caixa com 24 unidades. Sugestão de Marca: Ethicon - Código: G181T
96Unidade


20267/2022
30/05/2022 19:00:00
Dispensa de licitação
963/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Torneira
Descrição: * Torneira Elétrica Lorenzetti Versátil 220V 5500w Branca Com bica alta, 04 temperaturas, registro ¼ de volta e troca de resistência de fácil acesso. Possui bica alta e móvel, que facilita sua utilização no dia-a-dia.4 Temperaturas. Prático Registro 1/4 de volta com pastilha cerâmica. Segurança e facilidade no manuseio. Menor desgaste por tempo de uso.
1Unidade


20268/2022
29/05/2022 16:00:00
Dispensa de licitação
964/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: placa
Descrição: PLACA RETA 2.0 X 7 FUROS
2Unidade
Produto/Serviço: placa
Descrição: PLACA RETA 2.0 X 8 FUROS
2Unidade
Produto/Serviço: parafuso
Descrição: PARAFUSO BLOQUEADO 2.0 X 06MM
5Unidade
Produto/Serviço: parafuso
Descrição: PARAFUSO CORTICAL 2.0 X 14MM
5Unidade
Produto/Serviço: placa
Descrição: PLACA RETA 2.0 X 10 FUROS
2Unidade
Produto/Serviço: parafuso
Descrição: PARAFUSO BLOQUEADO 2.0 X 12MM
15Unidade
Produto/Serviço: parafuso
Descrição: PARAFUSO BLOQUEADO 2.0 X 14MM
15Unidade
Produto/Serviço: parafuso
Descrição: PARAFUSO BLOQUEADO 2.0 X 20MM
5Unidade


20269/2022
30/05/2022 16:00:00
Dispensa de licitação
965/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Serragem
Descrição: Serragem, aproximadamente 26 metros cúbicos. Entrega programada em duas etapas, com intervalo de 15 dias após a primeira entrega.
52Metro cúbico


20270/2022
30/05/2022 20:00:00
Dispensa de licitação
966/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: placa
Descrição: PLACA RECONSTRUCÃO 2.7 X 14F
2Unidade
Produto/Serviço: parafuso
Descrição: PARAFUSO CORTICAL 2.7 X 24
5Unidade
Produto/Serviço: parafuso
Descrição: PARAFUSO BLOQ. 2.7 X 18
5Unidade


20272/2022
31/05/2022 16:00:00
Dispensa de licitação
967/2022 Contratação de Outros Serviços
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Inscrição no curso "XIII Encontro de Organismos de Avaliação da Conformidade - ENOAC
Descrição: O curso será realizado nos dias 6, 7, 8 e 9 de junho de 2022. Inscrição do Coordenador do Projeto: Leorges Moraes da Fonseca e da Gerente de Qualidade do Projeto: Rosemary dos Santos Conrrado.
2Unidade


20273/2022
30/05/2022 16:00:00
Dispensa de licitação
968/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: TRIANCINOLONA 3MG/ML SOLUÇÃO INJETÁVEL - AMPOLA C/ 1ML (MEDICAMENTO MANIPULADO)
Descrição: TRIANCINOLONA 3MG/ML SOLUÇÃO INJETÁVEL - AMPOLA C/ 1ML (MEDICAMENTO MANIPULADO)
10Unidade


20395/2022
29/05/2022 16:00:00
Dispensa de licitação
970/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: serviço de manutenção de equipamentos
Descrição: MANUTENÇÃO PREVENTIVA NANODROP LITE
1Unidade


20495/2022
29/05/2022 16:00:00
Dispensa de licitação
973/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Ponteira azul 1000uL
Descrição: Ponteira de 100-1000µl, sem filtro, de polipropileno, cor neutra transparente, livre de DNA, DNASe, RNASe e inibidores de PCR,embalada em pacote com 500 unds - cod 70.3050, cx com 10 pctes.
1Caixa
Produto/Serviço: Ponteira branca micro 0,5-10µl
Descrição: Ponteira de 0,1-10µl, curta sem filtro, de polipropileno, cor neutra transparente, livre de DNA, DNASe, RNASe e inibidores de PCR,embalada em pacote com 1000 unds, cod 70.3010, cx com 10 pctes.
1Caixa
Produto/Serviço: Placa para PCR, 96 poços
Descrição: Placa para PCR, 96 poços, de polipropileno, meia borda, identificação alfa numérica, livre de DNA, DNASe, RNAse e pirogênios, cód. 72.1979 Cx com 100 unds.
1Caixa


20496/2022
30/05/2022 16:00:00
Dispensa de licitação
974/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Gaiola para cobaias (porquinho-da india)
Descrição: Medidas da gaiola: Altura 42cm Largura 38 cm Comprimento: 55 cm Observação: Pode ser um tamanho aproximado, pois a cobaia tem cerca de 700 gramas de peso.
10Caixa
Produto/Serviço: Recarga de Oxigênio medicinal para cilindro de 1,60m
Descrição: Recarga de Oxigênio medicinal (já possuo o cilindro de 1,60m)
1Bobina
Produto/Serviço: Válvula do cilindro de oxigênio
Descrição: Válvula para cilindro de oxigênio, RF350-125-AB218
1Unidade


20523/2022
29/05/2022 16:00:00
Dispensa de licitação
975/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Sangue de carneiro desfrinido
Descrição: Sangue desfibrinado de carneiro - frasco 50mL
12Frasco


20582/2022
29/05/2022 16:00:00
Dispensa de licitação
976/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Placa para ELISA – 96 poços em poliestireno – HIGH BINDING - cód 3590
Descrição: Placa para ELISA – 96 poços – sem tampa – em poliestireno – HIGH BINDING - embalada individualmente – caixa com 100 unidades – cód 3590.
2Caixa


20584/2022
29/05/2022 16:00:00
Dispensa de licitação
978/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: DEXMEDETOMIDINA 0,5MG/ML - FRASCO 10ML
Descrição: DEXMEDETOMIDINA 0,5MG/ML - FRASCO 10ML. Medicamento com registro no MAPA. ENTREGAR CONFORME PROGRAMAÇÃO VALIDADE NO MÍNIMO DE 1 ANO NA DATA DE ENTREGA
4Frasco


20585/2022
29/05/2022 16:00:00
Dispensa de licitação
979/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: DIPIRONA SÓDICA 500 MG/ML - SOLUÇÃO INJETÁVEL FRASCO COM 50ML
Descrição: DIPIRONA SÓDICA 500 MG/ML - SOLUÇÃO INJETÁVEL FRASCO COM 50ML. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOGE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, LICENCIADO NO MAPA. REGISTRO NO MAPA. VALIDADE DO PRODUTO DEVE SER NO MÍNIMO 1 ANO NA DATA DA ENTEGA NA INSTITUIÇÃO.
30Frasco


20587/2022
29/05/2022 16:00:00
Dispensa de licitação
981/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ESCOVA DEGERMANTE COM GLICONATO DE CLOREXIDINA
Descrição: ESCOVA DEGERMANTE COM GLICONATO DE CLOREXIDINA: escova degermante com gliconato de clorexidina: dupla face para degermação da pele, descartável, com corpo em material plástico, atóxico, apirogênico, flexível, livre de defeitos, tendo em uma das faces, cerdas macias que não causem abrasão e na outra esponja macia de poliuretano, impregnada com 2 ml de solução de gliconato de clorexidina a 2%. embalagem individual com selagem eficiente que garanta a integridade do produto até o momento de sua utilzação, permita a abertura e a transferência com técnica asséptica, trazendo externamente os dados de identifcação, procedência, número de lote, data de fabricação, prazo validade mínimo deve ser de 12 meses a partir da data de entrega. O material deve ter registro válido na ANVISA.
576Unidade


20589/2022
29/05/2022 16:00:00
Dispensa de licitação
982/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: EXTENSOR 20 CM, COM LUER LOCK E COM CONTROLADOR DE FLUXO TIPO PINÇA
Descrição: Extensor 20 cm com controlador de fluxo tipo pinça (clamp) em pvc com conector luer fêmea e luer lock reversível transparentes, com pega não inferior a 1,5 cm. Estéril, apirogênico, atóxico, embalado individualmente em papel grau cirúrgico ou filme termoplástico contendo os dados impressos de identificação, lote, data de fabricação e validade e registro Anvisa/MS.
1000Unidade


20669/2022
29/05/2022 16:00:00
Dispensa de licitação
984/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Primer Forward EHDV
Descrição: Primer Forward ID: EHDV_15-32F Sequência 5'-3': ATGTCAGCTGCGGTYTTG Purificação: Dessalinização
1Unidade
Produto/Serviço: Primer Reverse EHDV
Descrição: ID: EHDV_112-85R Sequência 5'-3': TCCCAATCAACTAARTGRATYTGVATCT Purificação: Dessalinização
2Unidade


20734/2022
29/05/2022 16:00:00
Dispensa de licitação
985/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AgraQuant Desoxinivalenol (250-5000 ppb) - 96 poços
Descrição: AgraQuant Desoxinivalenol (250-5000 ppb) - 96 poços Validade: no mínimo 6 meses a contar da data de entrega do material.
1Kit
Produto/Serviço: AgraQuant Ocratoxina (2-40 ppb) - 96 poços
Descrição: AgraQuant Ocratoxina (2-40 ppb) - 96 poços Validade: no mínimo 6 meses a contar da data de entrega do material.
1Kit


20735/2022
28/05/2022 16:00:00
Dispensa de licitação
986/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Agar Sabouraud Dextrose (SDA) 500g
Descrição: Agar Sabouraud Dextrose (SDA) 500g
2Frasco


20736/2022
28/05/2022 16:00:00
Dispensa de licitação
987/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Mix Enzima Go Taq
Descrição: Mix Enzima Go Taq, código M7433,
3Kit


20755/2022
29/05/2022 16:00:00
Dispensa de licitação
988/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Extrato de levedura frasco 500g, padrão cat n. K25-1702.
Descrição: Extrato de levedura frasco 500g, padrão cat n. K25-1702.
1Unidade
Produto/Serviço: Gelatina para Microbiologia, frasco 500 g, cat. nº ACU-NCM0204A
Descrição: Gelatina para Microbiologia, frasco 500 g, cat. nº ACU-NCM0204A.
1Unidade
Produto/Serviço: TRIPTONA P.A., FRASCO 500G, cat. nº K25-1612.
Descrição: TRIPTONA P.A., FRASCO 500G, cat. nº K25-1612.
1Unidade
Produto/Serviço: Calcium chloride dihydrate, BioReagent, suitable for cell culture, frasco 500 g,cat.n. C7902-500G.
Descrição: Calcium chloride dihydrate, BioReagent, suitable for cell culture, frasco 500 g. cat.n. C7902-500G
1Frasco


20756/2022
28/05/2022 16:00:00
Dispensa de licitação
989/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Pastorex Strep: A, B, C, D, F, G (Complete kit including extraction enzyme, controls, disposable cards and sticks) 61721.
Descrição: Pastorex Strep: A, B, C, D, F, G (Complete kit including extraction enzyme, controls, disposable cards and sticks) 61721.
1Kit


20836/2022
29/05/2022 16:00:00
Dispensa de licitação
990/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: acetona P.A
Descrição: Acetona P.A CAS:67-64-1 Fórmula Molecular: C3H6O Peso Molecular: 58,08g/mol Concentração: 99% Densidade: 0,79 Risco: 33 ONU: 1090
3Litro
Produto/Serviço: Micropipeta
Descrição: Micropipeta monocanal com volume variável 1 a 10 mL. Pipetas de deslocamento de ar, fabricação em polímero ABS e pistão de PVDF com alta resistência química, Display grande, com incrementos de 0,01 mL. Descanso de dedo, resistente a luz uv, cone autoclavavel,
1Unidade
Produto/Serviço: Micropipeta
Descrição: Micropipeta monocanal com volume variável 5 a 50 uL. Pipetas de deslocamento de ar, fabricação em polímero ABS e pistão de PVDF com alta resistência química, Display grande, com incrementos de 0,002 uL. Descanso de dedo, resistente a luz uv, cone autoclavavel,
1Unidade
Produto/Serviço: Reagente
Descrição: Indigo trissulfonato de potassio (Potassium indigotrisulfonate). CAS 67627-18-3, massa molecular: 616,72 g mol. pureza: >80% Synonyms : Indigo-5,5',7-trisulfonic acidtripotassium salt 5,5',7-Indigotrisulfonic acidtripotassium salt Potassium indigotrisulfonate tri-Potassium indigo-5,5',7-trisulfonate Tripotassium indigo-5,5',7-trisulfonate Formula : C16H7K3N2O11S3 Molecular weight : 616,72 g/mol
1Grama


20837/2022
29/05/2022 16:00:00
Dispensa de licitação
991/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Micropipeta
Descrição: Micropipeta Multicanal volume variável com 8 canais - 50 a 300uL
1Unidade
Produto/Serviço: Data Logger registrador de temperatura e umidade do ar
Descrição: Data Logger registrador de temperatura e umidade do ar
3Unidade
Produto/Serviço: phmetro
Descrição: pHmetro digital portátil
2Unidade
Produto/Serviço: Destilador de nitrogênio para sistema micro-Kjeldahl
Descrição: Destilador de nitrogênio para sistema micro-Kjeldahl
1Unidade


20936/2022
30/05/2022 16:00:00
Dispensa de licitação
992/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Agar M-Enterococcus
Descrição: Agar M-Enterococcus - Frasco c/ 500g
1Frasco
Produto/Serviço: ÁGAR SALMONELLA-SHIGELLA (SS)
Descrição: Ágar Agar Shigella-Salmonella - Frasco c/ 500 g
1Frasco
Produto/Serviço: Ágar Müller-Hinton - Frasco c/ 500 g
Descrição: Ágar Müller-Hinton - Frasco c/ 500 g
2Frasco


21010/2022
31/05/2022 16:00:00
Inexigibilidade de licitação
4/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Bronopol Spectrum Microtabs II Broad Spectrum Microtabs-II — frasco com 35.000 tabletes.
Descrição: Bronopol Spectrum Microtabs II Broad Spectrum Microtabs-II — frasco com 35.000 tabletes.
12Frasco


21034/2022
29/05/2022 16:00:00
Dispensa de licitação
993/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: serviço de impressão
Descrição: Serviço de impressão de 9 volumes do Cadernos Técnicos, sendo que do volume 95 ao 99 serão 1000 exemplares de cada e do 100 ao 103 serão 650 de cada. Para fins de cotação serão disponibilizados os arquivos com a quantidade de páginas de cada volume. CAPA aberta 22,5x31,4 em 4x0 cores. Tinta escala, em couche liso 170g. CTP ecológico. Páginas miolo 15,5x 22,5 em 4 cores. Tinta escala, em couche fosco 90g. CTP ecológico. Intercalado, cola PUR - lombada quadrada. Laminação brilho=1 lado (capa).
7600Unidade


21061/2022
30/05/2022 16:00:00
Dispensa de licitação
995/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Envision flex+ mouse, high pH (link)
Descrição: Kit de sistema de detecção para imuno-histoquímica
1Kit
Produto/Serviço: Flex IHC microscope slides
Descrição: Lâminas com carga elétrica para execução de imuno-histoquímica
1Caixa
Produto/Serviço: flex monoclonal CD68
Descrição: Anticorpo CD68 pronto para uso para imuno-histoquímica em tecidos parafinados.
1Frasco
Produto/Serviço: flex monoclonal mouse anti-human CD4
Descrição: Anticorpo CD4 pronto para uso para imuno-histoquímica em tecidos parafinados.
1Frasco
Produto/Serviço: flex monoclonal mouse anti-human cd8
Descrição: Anticorpo CD8 pronto para uso para imuno-histoquímica em tecidos parafinados.
1Frasco
Produto/Serviço: flex monoclonal anti-human ki67 antigen
Descrição: Anticorpo ki67 pronto para uso para imuno-histoquímica em tecidos parafinados.
1Frasco


21065/2022
30/05/2022 16:00:00
Dispensa de licitação
997/2022 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: bebedouro chupeta para suínos adultos
Descrição: Bebedouros Chupetas Inox Para Suíno Adulto
5Unidade


21066/2022
30/05/2022 16:00:00
Dispensa de licitação
998/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Hemoglobina Bovina
Descrição: BBL™ Hemoglobin, Bovine, Freeze-Dried - 500g
5Frasco


21090/2022
31/05/2022 16:00:00
Dispensa de licitação
999/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Adaptadores Nextera 10 pb set A da IDT
Descrição: Adaptadores Nextera 10 pb set A para sequenciamento de ultima geração (NGS)
1Frasco
Produto/Serviço: Adaptadores Nextera 10 pb set B da IDT
Descrição: Adaptadores Nextera 10 pb set B para sequenciamento de ultima geração (NGS)
1Frasco


21174/2022
31/05/2022 16:00:00
Dispensa de licitação
1000/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Placa de Petri 90 x 15 descartável
Descrição: Placa de Petri 90 x 15 descartável
4000Unidade


21184/2022
30/05/2022 16:00:00
Dispensa de licitação
1001/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FIO GUIA AQUALINER STIFF
Descrição: FIO GUIA AQUALINER STIFF
1Unidade
Produto/Serviço: BALÃO DE ANG. Nylotrack 35 Suprapatela - Convencional
Descrição: BALÃO DE ANG. Nylotrack 35 Suprapatela - Convencional
1Unidade
Produto/Serviço: STENT AUTOEXPANSIVEL SINUS SUPERFLEX 635 - 9x60 mm
Descrição: STENT AUTOEXPANSIVEL SINUS SUPERFLEX 635 - 9x60 mm ANVISA - 81504790149 Código - Ref. 86060-7120
1Unidade
Produto/Serviço: SERINGA INSUFLADORA 20 ML
Descrição: SERINGA INSUFLADORA 20 ML ANVISA 80446140008 Código de Ref. SM-10-A2530H
1Unidade


21187/2022
31/05/2022 16:00:00
Dispensa de licitação
1003/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L 2.7X5F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L 2.7X5F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L 2.7X6F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L 2.7X6F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ILIO 2.7 CURTA DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ILIO 2.7 CURTA ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ILIO 2.7 LONGA DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ILIO 2.7 LONGA ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA LATERAL DISTAL FEMUR 2.7X06F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA LATERAL DISTAL FEMUR 2.7X06FESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA LATERAL DISTAL FEMUR 2.7X07F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA LATERAL DISTAL FEMUR 2.7X07F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L ANGULADA 2.7X5F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L ANGULADA 2.7X5F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L ANGULADA 2.7X6F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L ANGULADA 2.7X6F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ARTRODESE 2.7X2.0X07F
1Unidade
Produto/Serviço: placa
Descrição: PLACA ARTRODESE 27.X2.0X08F
1Unidade
Produto/Serviço: placa
Descrição: PLACA ANTERO DISTAL UMERO 2.7X06F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ANTERO DISTAL UMERO 2.7X06F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ANTERO DISTAL UMERO 2.7X07F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ANTERO DISTAL UMERO 2.7X07F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA TPLO 2.7 DIR CURTA (50-27-01)
1Unidade
Produto/Serviço: placa
Descrição: PLACA TPLO2.7 DIR LONGA (50-27-02)
1Unidade
Produto/Serviço: placa
Descrição: PLACA TPLO 2.7 ESQ CURTA (60-27-01)
1Unidade
Produto/Serviço: placa
Descrição: PLACA TPLO 2.7 ESQ LONGA (60-27-02)
1Unidade
Produto/Serviço: placa
Descrição: PLACA DE ARTRODESE 2.7X2.0X07F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA DE ARTRODESE 2.7X2.0X07F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA DE ARTRODESE 2.7X2.0X08F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA DE ARTRODESE 2.7X2.0X08F ESQUERDA
1Unidade
Produto/Serviço: parafuso
Descrição: PARAFUSO CORTICAL 2.7 X 24
5Unidade


21188/2022
30/05/2022 16:00:00
Dispensa de licitação
1004/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L 1.5X4F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L 1.5X4F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L 1.5X5F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L 1.5X5F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ILIO 1.5 CURTA DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ILIO 1.5 CURTA ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ILIO 1.5 LONGA DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ILIO 1.5 LONGA ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA LATERAL DISTAL FEMUR 1.5X05F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA LATERAL DISTAL FEMUR 1.5X05F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA LATERAL DISTAL FEMUR 1.5X06F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA LATERAL DISTAL FEMUR 1.5X06F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L ANGULADA 1.5X4F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L ANGULADA 1.5X4F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L ANGULADA 1.5X5F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA CONDILAR L ANGULADA 1.5X5F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ARTRODESE 1.5X1.2X07F
1Unidade
Produto/Serviço: placa
Descrição: PLACA ARTRODESE 1.5X1.2X08F
1Unidade
Produto/Serviço: placa
Descrição: PLACA ANTERO DISTAL UMERO 1.5X06F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ANTERO DISTAL UMERO 1.5X06F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ANTERO DISTAL UMERO 1.5X07F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA ANTERO DISTAL UMERO 1.5X07F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA DE ARTRODESE 1.5X1.2X07F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA DE ARTRODESE 1.5X1.2X07F ESQUERDA
1Unidade
Produto/Serviço: placa
Descrição: PLACA DE ARTRODESE 1.5X1.2X08F DIREITA
1Unidade
Produto/Serviço: placa
Descrição: PLACA DE ARTRODESE 1.5X1.2X08F ESQUERDA
1Unidade


21189/2022
31/05/2022 16:00:00
Dispensa de licitação
1005/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: COLAR ELIZABETANO No 5 COM COLEIRA
Descrição: Descrição: COLAR ELIZABETANO COM COLEIRA No 5 - colar elizabetano de polipropileno na forma de cone, na cor preta, contendo presilhas de plástico para fechamento, plástico nas extremidades e tiras para passar a coleira
15Unidade
Produto/Serviço: COLAR ELIZABETANO No 4 COM COLEIRA
Descrição: COLAR ELIZABETANO No 4 - Descrição: COLAR ELIZABETANO COM COLEIRA No 4 - colar elizabetano de polipropileno na forma de cone,na cor preta,contendo presilhas de plástico para fechamento, plástico nas extremidades e tiras para passar a coleira
15Unidade
Produto/Serviço: COLAR ELIZABETANO No 6 COM COLEIRA
Descrição: COLAR ELIZABETANO No 6 COM COLEIRA Descrição: COLAR ELIZABETANO No 6 - colar elizabetano de polipropileno na forma de cone, na cor preta, contendo presilhas de plástico para fechamento, plástico nas extremidades, contendo coleira em couro e tiras para passar a coleira. Dimensão da circunferência do pescoço de aproximadamente 50 cm.
10Unidade


21190/2022
31/05/2022 16:00:00
Dispensa de licitação
1006/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: MORFINA, SULFATO 1 MG/ML - SOLUÇÃO INJETÁVEL AMPOLA C/2 ML.
Descrição: MORFINA, SULFATO 1 MG/ML - SOLUÇÃO INJETÁVEL AMPOLA C/2 ML. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO.
50Ampola


21191/2022
30/05/2022 16:00:00
Dispensa de licitação
1007/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: caneta
Descrição: Descrição: Caneta monopolar de comando pedal com eletrodo para eletrocautério, com plugue universal de 01 pino, •Controle através de pedal que aciona as funções de corte e coagulação. •Caneta Padrão Autoclavável •Mandril para eletrodos de Ø 1,6 mm a Ø 2,38 mm •Cabo fixo de silicone com 3,0 metros. Conector isolado com pino Ø 3,97 mm para conexão com o bisturi. •Registro ANVISA/MS •Constituídas por corpo, plugue e ponta em poliacetal; mandril em latão cromado para encaixe dos eletrodos e cabo de silicone de 4,0 mm x 3,0m de comprimento. Aceitam eletrodos com hastes entre Ø 1,6 mm a Ø 2,38 mm, oferecendo versatilidade para os procedimentos gerais de eletrocirurgia. Potência de até 400 watts. Solicita-se envio de fotos da caneta orçada.
5Unidade


21193/2022
31/05/2022 16:00:00
Dispensa de licitação
1009/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ATADURA TIPO CREPOM, 8 CM, EMBALAGEM INDIVIDUAL
Descrição: ATADURA TIPO CREPOM, 8 CM ±Atadura de Crepom tipo I medindo 8cm de largura por 1,80m em repouso de comprimento, com densidade de 13 fios/cm², com peso de 13,3g por unidade, confeccionada em tecido 100% algodão cru, fios de alta torção, possuindo bastante elasticidade no sentido longitudinal, enroladas sobre si mesmas, aparência uniforme, bordas devidamente acabadas, isenta de rasgos, impurezas, fiapos e quaisquer outros tipos de defeitos que possam afetar seu desempenho durante o uso.
156Unidade
Produto/Serviço: ATADURA TIPO CREPOM, 15 CM EMBALAGEM INDIVIDUAL
Descrição: ATADURA TIPO CREPOM, 15 CM EMBALAGEM INDIVIDUAL ±Atadura de Crepom tipo I medindo 15cm de largura por 1,80m em repouso de comprimento, com densidade de 13 fios/cm², com peso de 13,3g por unidade, confeccionada em tecido 100% algodão cru, fios de alta torção, possuindo bastante elasticidade no sentido longitudinal, enroladas sobre si mesmas, aparência uniforme, bordas devidamente acabadas, isenta de rasgos, impurezas, fiapos e quaisquer outros tipos de defeitos que possam afetar seu desempenho durante o uso.
720Unidade


21195/2022
30/05/2022 16:00:00
Dispensa de licitação
1010/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CEFTRIAXONA 1G - PÓ LIOFILIZADO P/ SOLUÇÃO INJETÁVEL
Descrição: CEFTRIAXONA 1G - PÓ LIOFILIZADO P/ SOLUÇÃO INJETÁVEL MEDICAMENTO COM REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA NA ANVISA.
100Unidade


21196/2022
01/06/2022 16:00:00
Dispensa de licitação
1011/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Placas de 96 well para cultivo celular
Descrição: Placas de 96 poços para cultivo celular, de fundo plano, transparente, tratada com TC, embalada individualmente, com tampa de baixa evaporação, estéril.
40Unidade
Produto/Serviço: Frasco Criogênico de Polipropileno Roscado Externo de 2 mL
Descrição: Criotubo de 2,0ml,volume de trabalho 1,8ml, tampa com rosca externa , de polipropileno, base auto sustentável, graduado, tarja para identificação, estéril, livre de pirogênios e endotoxinas, não citotóxico, faixa de temperatura 121°C a -196°C Pacote com 500 unidades
1Pacote
Produto/Serviço: Frasco Criogênico de Polipropileno Roscado Externo de 5 mL
Descrição: Criotubo de 5,0ml, tampa com rosca externa , de polipropileno, base auto sustentável, graduado, tarja para identificação, estéril, livre de pirogênios e endotoxinas, não citotóxico, faixa de temperatura 121°C a -196°C Pacote com 250 unidades
2Pacote
Produto/Serviço: Pipeta Sorológica descartável 2mL
Descrição: Pipeta sorológica descartável, de poliestireno, 2ml, graduada, estéril, livre de pirogênios, embalada individualmente
250Unidade
Produto/Serviço: Pipeta sorológica descartável 5ml
Descrição: Pipeta sorológica descartável, de poliestireno, 5ml, graduada, estéril, livre de pirogênios, embalada individualmente
500Unidade
Produto/Serviço: Pipeta sorológica descartável 10ml,
Descrição: Pipeta sorológica descartável, de poliestireno, 10ml, graduada, estéril, livre de pirogênios, embalada individualmente
250Unidade
Produto/Serviço: Garrafa de cultivo celular A175 ou A182 sem filtro com estagio de aeração
Descrição: Garrafa para cultura de células, área de crescimento 175cm2,tampa de rosca sem filtro , superfície tratada para adesão celular, gargalo inclinado, estéril, livre de pirogênios, não citotóxica , embalada em pacote com 5unds Caixa com 8 pacotes TOTAL DE GARRAFAS REQUERIDAS: 80 UNIDADES Validade maior que 5 anos (ou maior possível)
2Caixa
Produto/Serviço: Cloreto de Sódio PA
Descrição: Cloreto de Sódio PA 500g (se não tiver pode ser 1kg) Validade de pelo menos 4 anos
1Frasco
Produto/Serviço: cloreto de potássio PA
Descrição: cloreto de potássio PA 500g (se não tiver pode ser 1kg) Validade de pelo menos 4 anos
1Frasco
Produto/Serviço: fosfato de potássio monobásico anidro PA
Descrição: fosfato de potássio monobásico anidro PA, 500G - Validade de pelo menos 4 anos
1Frasco
Produto/Serviço: FOSFATO DE SÓDIO DIBASICO ANIDRO PA
Descrição: FOSFATO DE SÓDIO DIBASICO ANIDRO PA 500G (ne nao tiver, pode ser 1kg) Validade maior que 4 anos
1Frasco


21306/2022
31/05/2022 16:00:00
Dispensa de licitação
1012/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Placa de Petri 90x15mm, PS, lisa, estéril, cx. c/200 unidades
Descrição: Placa de Petri 90 x 15mm, poliestireno, lisa, estéril, caixa com 200 unidades. Cralplast ou similares
2Caixa
Produto/Serviço: Álcool Etílico Hidratado 70° INPM, 1 Litro
Descrição: Álcool Etílico Hidratado 70° INPM, 1 Litro
6Frasco
Produto/Serviço: Agar Sabouraud Dextrose (SDA) 500g
Descrição: Agar Sabouraud Dextrose (SDA) 500g
1Frasco


21308/2022
31/05/2022 16:00:00
Dispensa de licitação
1013/2022 Material de construção
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: areia
Descrição: Areia sanitária/ higiênica para gatos. Sem aroma/cheiro. Cada saco possui 15 kg
4Saco


21309/2022
01/06/2022 16:00:00
Dispensa de licitação
1014/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FILTRO ANTIBACTERIANO DE 0,2 MICRONS
Descrição: FILTRO ANTIBACTERIANO DE 0,2 MICRONS Embalagem unitária contendo número de lote, data fabricação e validade. Registro na Anvisa/M
50Unidade


21310/2022
31/05/2022 16:00:00
Dispensa de licitação
1015/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AMOXICILINA 1000MG + ACIDO CLAVULÂNICO 200MG - PÓ INJETÁVEL FRC
Descrição: AMOXICILINA 1000MG + ÁCIDO CLAVULÂNICO 200MG - PÓ INJETÁVEL ) Validade de no mínimo 1 ano no momento da entrega na farmácia. Medicamento com registro na ANVISA
400Frasco


21312/2022
31/05/2022 16:00:00
Dispensa de licitação
1016/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ATIPAMEZOLE 5,0MG/ML, FRASCO COM 10ML
Descrição: ATIPAMEZOLE 5,0MG/ML, FRASCO COM 10ML. Medicamento registrado no MAPA. Validade de no mínimo 1 ano na data da entrega.
4Unidade


21314/2022
31/05/2022 16:00:00
Dispensa de licitação
1018/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CATETER INTRAVENOSO INSYTE 20GA X 1.16"
Descrição: CATETER INTRAVENOSO INSYTE 20GA (curto) X 1.16" cateter intravenoso radiopaco estéril, 20GA X 1.16´1,1 x 30mm, 60mL/min, para terapia intravenosa periférica. Esterilizado por óxido de etileno. Embalagem individual conforme legislação vigente, registro no M.S. ANVISA, contendo especificação do produto, fabricante, número de lote, data de fabricação, prazo de validade, SAC padronização de cores de acordo com NBR ISSO10555-5
1200Unidade


21504/2022
01/06/2022 16:00:00
Dispensa de licitação
1019/2022 Contratação de Outros Serviços
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Projeto Gráfico e formatação da Coletânea
Descrição: Projeto Gráfico e Formatação de livro com média de 550 páginas, p&b, e capa colorida. Inclui neste orçamento, provas digitais para conferência.
1Unidade


21555/2022
01/06/2022 16:00:00
Dispensa de licitação
1022/2022 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Papel para Impressora
Descrição: Aquisição de material de consumo Papel para Impressora Cobas MIRA PLUS
25Rolo


21556/2022
01/06/2022 16:00:00
Dispensa de licitação
1023/2022 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Lona Azul Reforçada 8x4 metros 70 Grs 100 micras AJAX
Descrição: Lona Azul Reforçada 8x4 metros 70 Grs 100 micras AJAX
3Unidade


21557/2022
01/06/2022 16:00:00
Dispensa de licitação
1024/2022 Equipamentos/Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: manutenção preventiva e corretiva em impressora multifuncional MFC-L6902DW Brother.
Descrição: Equipamento está travando as folhas a todo momento durante a impressão (em especial quando faz a impressão no lado contrário da folha), ocorre com frequência quando faz muitas impressões seguidas.
1Unidade


21577/2022
01/06/2022 16:00:00
Dispensa de licitação
1025/2022 Material de construção
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Caixas de água de polietileno de 750 L
Descrição: Caixas de água de polietileno de 750 L de capacidade.
30Unidade


21667/2022
01/06/2022 16:00:00
Dispensa de licitação
1026/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: iodeto de potássio
Descrição: Iodeto de potássio P.A. frasco -500gramas
5Frasco


21668/2022
01/06/2022 16:00:00
Dispensa de licitação
1027/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: placa de petri
Descrição: Placas de Petri em poliestireno, descartável, estéril , sem divisória. dimensão 90x15 mm
20000Unidade


21688/2022
01/06/2022 16:00:00
Dispensa de licitação
1028/2022 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Certificação de fluxo laminar
Descrição: Certificação de Fluxo laminar Avaliação da segurança do equipamento para manipulação de cultivo celular assegurando sua esterilidade, bem como manipulação de vírus. Capela da Marca VECO, modelo VLFS09M nº de série:FL-2477 SALA E209
1Unidade