ÁREA DO FORNECEDOR

ACESSO RESTRITO












Destaques


A FEPE recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
36777/2019
21/01/2020 16:00:00
Dispensa de licitação
1424/2019 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AMINOFILINA, SOLUÇÃO INJETÁVEL 24MG/ML, AMPOLA 10ML
Descrição: AMINOFILINA SOLUÇÃO INJETÁVEL 24MG/ML, AMPOLA 10ML, CAIXA COM 50 AMPOLAS OBS: VALIDADE DE NO MÍNIMO 1 ANO NA DATA DE ENTREGA
50Ampola
Produto/Serviço: SALBUTAMOL, SOLUÇÃO PARA NEBULIZAÇÃO, FRASCO 10 ML
Descrição: SALBUTAMOL, Solução para nebulização, apresentado em frascos de 10 mL. Cada frasco contém 5 mg de salbutamol, na forma de sulfato, por mililitro de solução. obs: VALIDADE DE NO MÍNIMO DE 1 ANO NA DATA DE ENTREGA
5Frasco
Produto/Serviço: PROPIONATO DE FLUTICASONA, SOLUÇÃO PARA NEBULIZAÇÃO 2MG/2ML, AMPOLA DE 2ML
Descrição: PROPIONATO DE FLUTICASONA, SOLUÇÃO PARA NEBULIZAÇÃO 2MG/2ML, AMPOLA DE 2ML, CAIXA COM 5 AMPOLAS. OBS: VALIDADE DE NO MÍNIMO 1 ANO NA DATA DE ENTREGA
5Ampola
Produto/Serviço: KIT PARA NEBULIZAÇÃO INFANTIL
Descrição: KIT PARA NEBULIZAÇÃO INFANTIL CONTENDO EXTENSÃO COM CONEXÃO PARA OXIGÊNIO, COM RECIPIENTE PARA MEDICAMENTO, COM MÁSCARA ADULTA E COM ELÁSTICO Dimensões (LxAxC): 11cm x 7cm x 15cm Peso : 0,40 kg.
2Unidade


41041/2019
24/01/2020 14:00:00
Dispensa de licitação
1548/2019 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Acetilcisteína 100mg/mL, solução injetável ampolas 3mL
Descrição: Acetilcisteína 100mg/mL, solução injetável ampolas 3mL. Caixa com 5 ampolas. Registro na ANVISA, responsável Técnico. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO.
10Ampola
Produto/Serviço: Cloreto de Benzalcônio 15g/100mL. Frasco de 1000mL.
Descrição: Cloreto de Benzalcônio 15g/100mL. Frasco de 1000mL. Solução desinfetante. Registro no MAPA. Validade de no mínimo 1 ano no momento de entrega na instituição. SUGESTÃO DE MARCA: HerbalVet (Ouro Fino) ou VET + 20 (Herbal)
1Frasco
Produto/Serviço: Levetiracetam 100mg/mL Solução oral. Frasco 150mL.
Descrição: Levetiracetam 100mg/mL Solução oral. Frasco 150mL. Registro na Anvisa. Responsável Ténico. Validade de no mínimo 75% do prazo de validade total no momento da entrega na instituição.
1Frasco
Produto/Serviço: Polissulfato de Mucopolissacarídeo 5mg/g. Pomada. Bisnaga de 40g.
Descrição: Polissulfato de Mucopolissacarídeo 5mg/g. Pomada. Bisnaga de 40g. Registro na Anvisa. Responsável Técnico. Validade de no mínimo 1 ano no momento de entrega na instituição. SUGESTÃO DE MARCA: Hirudoid 500
2Bisnaga
Produto/Serviço: Sulfato de Magnésio (50%) 500mg/mL. solução injetável. Ampola de 10mL.
Descrição: Sulfato de Magnésio (50%) 500mg/mL. solução injetável. Ampola de 10mL. Caixa com 200 ampolas. Registro na Anvisa. responsável técnico. Validade de no mínimo 1 ano no momento da entrega na instituição.
1Caixa


43137/2019
23/01/2020 13:00:00
Dispensa de licitação
1603/2019 Passagens Aéreas
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: passagem aérea internacional
Descrição: passagem aérea internacional compra de 3 passagens áreas para os professores particparem do Congresso INSAR (International Society for Autism Research) 2020 professores: Ana Amélia Cardoso Rodrigues, Jardel Sander da Silva, Maria Luísa M. Nogueria Saída CNF 03/05/2020 retorno 09/05/2020
3Unidade


43138/2019
21/01/2020 16:00:00
Dispensa de licitação
1604/2019 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: VELCRO NEOPRENE
Descrição: Compra de 2 rolos de 25 metros. Total 50 metros. Velcro 10cm Macho e Fêmea Super Resistente 0,10x 100.O valor é referente a 1 metro macho com 10cm de largura + 1 metro fêmea 10cm de largura 70% poliéster e 30% nylon.
50Metro


45268/2019
24/01/2020 15:00:00
Dispensa de licitação
1694/2019 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: TELA DE POLIPROPILENO, TAMANHO 15X15 - CÓDIGO PMH1
Descrição: TELA DE POLIPROPILENO, TAMANHO 15X15 - tela do tipo flat mesh. Embalagem unitária contendo número do lote, data de fabricação e data de validade. Registro na anvisa/ms.
3Unidade


45449/2019
30/01/2020 16:00:00
Processo Seletivo Simplificado
22/2019 Contratação de Outros Serviços
Edital
Titulos
EDITAL 009_2019_FEPE - PROCESSO SELETIVO SIMPLIFICADO RESULTADO ENTREVISTA
resultado final

Produto/ServiçoQuant.Unidade
Produto/Serviço: Contratação de Pessoa Física
Descrição: Das Inscrições: As inscrições serão realizadas no período 04 a 12 de dezembro de 2019 das 09:00 às 11:00h de segunda à sexta-feira(exceto sábado, domingo e feriado), na Fundação de Apoio ao Ensino, Pesquisa e Extensão – FEPE, situada na Avenida Presidente Antônio Carlos, 6627, SubSolo da Escola de Veterinária da UFMG, Pampulha, Belo Horizonte/MG. 01 Técnico Nível II- Natação 01 R$ 3.000,00 (três mil reais) 02 Técnico Nível V- Atletismo 01 R$4.500,00 (quatro mil, quinhentos reais) Ticket Alimentação -R$ 385,00 Vale transporte – De acordo com endereço residencial e por opção do contratado conforme legislação vigente
2Unidade


45621/2019
21/01/2020 16:00:00
Dispensa de licitação
1705/2019 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: conversão de xml
Descrição: Conversão de arquivos ".doc" para "xml". Serão 6 volumes da Revista ABMVZ, no decorrer do ano 2020, a serem entregues virtualmente ao Scielo nos meses: fevereiro, abril, junho, agosto, outubro e dezembro. Solicita-se orçamento da conversão do total anual de 300 artigos.
300Unidade


47047/2019
24/01/2020 17:00:00
Dispensa de licitação
1764/2019 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FILTRO HEPA E PRE-FILTRO
Descrição: KIT FILTRO HEPA E PRE-FILTRO REPOSICAO PARA INCUBUBADORA CO2 Incubadora Thermo series 8000 wj.
1Unidade


47657/2019
24/01/2020 17:00:00
Dispensa de licitação
1782/2019 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: serviço de impressão
Descrição: Serviço de Impressão do Cadernos Técnicos 94 - capa aberta 22,5x31,4 em 4x0 cores. Tinta escala em couche liso 170g. CTP Ecológico. Páginas miolo 15,5x22,5 em 4 cores. Tinta escala em couche fosco 90g. CTP ecológico. Intercalado, cola PUR - lombada quadrada. Laminação brilho=1 lado (capa). Para verificar o número de páginas e cores, favor verificar o anexo (apenas para cotação).
1000Unidade


47745/2019
24/01/2020 13:00:00
Dispensa de licitação
1785/2019 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Pinça cirúrgica para biópsia uterina em aço inoxidável
Descrição: Pinça cirúrgica para biópsia uterina em aço inoxidável cirúrgico - aplicação Veterinária 50 a 55 cm de comprimento 3 milimetros de largura Mordida retangular grande com dentes superiores e inferiores - tipo mordida jacaré
1Unidade


48115/2019
21/01/2020 16:00:00
Dispensa de licitação
1792/2019 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: EXIGO DILUENT RFLD 10L
Descrição: EXIGO DILUENT RFLD 10L
4Unidade
Produto/Serviço: EXIGO LYSE RLFD 1,9L
Descrição: EXIGO LYSE RLFD 1,9L
2Unidade


204/2020
22/01/2020 16:00:00
Dispensa de licitação
12/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: lâminas nº 50 para máquina de tosa
Descrição: lâminas nº 50 para máquina de tosa- Tricotomia em Pets
15Unidade


601/2020
20/01/2020 16:00:00
Dispensa de licitação
21/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Sonda para PCR em tempo real IglC Probe
Descrição: Sonda para PCR em tempo real IglC Probe [6FAM] ATCTATTGGGCTCACAACTTCACAA [TAMRA] ou NFQ/BHQ1 Escala: 10 nmol
1Unidade


605/2020
20/01/2020 16:00:00
Dispensa de licitação
23/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Tripé de 1,70 metros
Descrição: • Fabricado em Alumínio para facilidade de transporte • Universal (Pode ser usado por qualquer câmera) • Suporte para auxiliar na mudança de posição • Manivela para mudança de altura Média • Travas para fixação da posição • Suporte de câmera destacável para agilidade em fotos sem o tripé ou mudança de acessórios • Anel Central Rosqueado (fixa os Pés do Tripé impedindo que o mesmo se desmonte acidentalmente) • Pés em borracha e ajuste de terreno para melhor estabilidade • Alavanca de ajuste de altura milimétrica • Gatilho de saque rápido Altura mínima 1,70 metros
2Unidade


618/2020
31/03/2020 16:00:00
Dispensa de licitação
25/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: MESA CIRÚRGICA PANTOGRÁFICA
Descrição: mesa cirúrgica pantográfica um motor, base inox, com elevação automática, tampo em inóx, vincos para escoamentos e balde para resíduos, comprimento 1,16m, e largura 60 cm. Com voltagem bivolt.
4Unidade
Produto/Serviço: Foco cirúrgico
Descrição: Foco Cirúrgico de teto, led, uma cúpula de diâmetro 250 mmm, 7 ledes por cúpula, potência luminosa de 40.000 lux, com ajuste de intensidade. Material da cúpula de aluminio e acrilico, e material dos braços de alumínio.
4Unidade
Produto/Serviço: Foco Cirurgico com Camera
Descrição: Foco Cirúrgico de teto, led, uma cúpula de diâmetro 480 mmm, 20 ledes por cúpula, potência luminosa de 100.000 lux, com ajuste de intensidade. Material da cúpula de aluminio e acrilico, e material dos braços de alumínio. Grau de efeito shadowless alto. Com camera com sensor de imagem (sensor 1/3 CMOS) digitalização progressiva, definição de imagem (1080p/60 (50) fps, 1080 p/30 (25) fps, 720p/60 (50) fps, 720 o/30 (25) fps), Distância Mínima de operação 10 mm; Saida de vídeoHD-SDI, Conector BNC 75 ohms ; Relação S/N Maior que 50 dB (AGC desligado); Zoom 10x óptico, 32x digital; Comprimento focal F = 5.1 mm ~ 51 mm; Relação de Abertura F1.6 (lateral) ~ F1.8 (profundidade); Foco Automático/Manual/Um toque; Exposição Modo/AGC/Velocidade do obturador/Íris/ DSS/ Cintilação/ Brilho/ WDR/ BLC/ Dia e Noite; Equilíbrio Branco Automático/ Um toque/ Manual/ Interno/ Externo
1Unidade
Produto/Serviço: MESA VETERINARIA DE PAREDE EM INOX
Descrição: MESA COM TAMPO DOBRÁVEL EM INOX E SUPORTE EM INOX PARA FIXAÇÃO NA PAREDE, LARGURA 60CM E ALTURA 90 CM.
3Unidade


622/2020
20/01/2020 16:00:00
Dispensa de licitação
27/2020 Hospedagem
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Hospedagem
Descrição: Hospedagem Cuiabá - MT - Chegada 10/02/2020 as 10:00 - Saída em 12/02/2020 as 14:00 - Obs. Conciliar com Horário do Vôo
2Dia
Produto/Serviço: Hospedagem
Descrição: Hospedagem Sinop - MT - Chegada 12/02/2020 as 15:30 - Saída em 14/02/2020 as 15:00 - Obs. Conciliar com Horário do Vôo
2Unidade


624/2020
20/01/2020 16:00:00
Dispensa de licitação
28/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: POTE TRANSPARENTE COM TAMPA DE 250ML
Descrição: Pote com Tampa. Capacidade: 250ml. Cor: Transparente. Composição: Resinas de Polipropileno e Aditivos. Pode ser Usado no Freezer ou Microondas.
150Unidade
Produto/Serviço: POTE TRANSPARENTE COM TAMPA DE 500ML
Descrição: Pote com Tampa. Capacidade: 500ml. Cor: Transparente. Composição: Resinas de Polipropileno e Aditivos. Pode ser Usado no Freezer ou Microondas.
250Unidade
Produto/Serviço: POTE TRANSPARENTE COM TAMPA DE 1000ML
Descrição: Pote com Tampa. Capacidade: 1000ml. Cor: Transparente. Composição: Resinas de Polipropileno e Aditivos. Pode ser Usado no Freezer ou Microondas
200Unidade


626/2020
20/01/2020 16:00:00
Dispensa de licitação
30/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AGULHA DE TUOHY 18G x 3,5
Descrição: AGULHA DE TUOHY 18G. Agulha técnica Descartável para anestesia regional com ponta tipo tuohy (curva) apirogênica e estéril. Embalagem unitária contendo número de lote, data fabricação e validade. Registro na Anvisa/MS.
12Unidade


628/2020
20/01/2020 16:00:00
Dispensa de licitação
31/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: DOBUTAMINA 12,5MG/ML - AMPOLA 20ML SOLUÇÃO INJETÁVEL.
Descrição: DOBUTAMINA 12,5MG/ML - AMPOLA 20ML SOLUÇÃO INJETÁVEL. MEDICAMENTO COM REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA
100Frasco


632/2020
20/01/2020 16:00:00
Dispensa de licitação
33/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Cartucho de Gases Sanguíneos - Tipo CG8. CAIXA C/ 25 UNIDADES
Descrição: Cartucho de Gases Sanguíneos - Tipo Cg8 - (Glicose, Na, K, iCa, Hct, Hb, pH, PCO2, PO2, TCO2, HCO3, BEecf, sO2).CAIXA COM 25 UNIDADES. VALIDADE SUPERIOR A 6 MESES.
4Caixa
Produto/Serviço: Cartucho de Bioquímica Tipo EC8+ - CAIXA C/ 25 UNIDADES
Descrição: Cartucho descartável Bioquímica - Tipo Ec8+ - (Uréia Nitrogenada, Glicose, Cl, Na, K, Hct, Hb, pH, PCO2, TCO2, HCO3, BEecf, Anion Gap). CAIXA COM 25 UNIDADES. VALIDADE SUPERIOR A 6 MESES
4Caixa


634/2020
20/01/2020 16:00:00
Pregão eletrônico
12/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: PAPEL TOALHA 2 DOBRAS BRANCO LUXO 20X22 CM C/1000 FOLHAS IMPACTA
Descrição: papel toalha fardo
4Fardo


636/2020
20/01/2020 16:00:00
Dispensa de licitação
36/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: PBS pH 7.4 (1X) - Phosphate Buffered Saline livre de cálcio e magnésio frasco de 500 mL - ESTÉRIL 10010-023
Descrição: PBS pH 7.4 (1X) - Phosphate Buffered Saline livre de cálcio e magnésio frasco de 500 mL - ESTÉRIL 10010-023 PEDIR DE MAIOR PRAZO DE VALIDADE POSSÍVEL
2Frasco


638/2020
20/01/2020 16:00:00
Dispensa de licitação
38/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: PIPETA SOROLOGICA GRADUADA COM CAPACIDADE DE 10 ML, graduação 1/10, estéril, não pirogênico, embalada separadamente; Fabricada em poliestireno transparente; PACOTE COM 10 UNIDADES
Descrição: PIPETA SOROLOGICA GRADUADA COM CAPACIDADE DE 10 ML, graduação 1/10, estéril, não pirogênico, embalada separadamente; Fabricada em poliestireno transparente; PACOTE COM 10 UNIDADES
100Unidade
Produto/Serviço: Material de PIPETA SOROLOGICA GRADUADA COM CAPACIDADE DE 05 ML, graduação 1/10, estéril, não pirogênico, embalada separadamente; Fabricada em poliestireno transparente; PACOTE COM 10 UNIDADES
Descrição: PIPETA SOROLOGICA GRADUADA COM CAPACIDADE DE 05 ML, graduação 1/10, estéril, não pirogênico, embalada separadamente; Fabricada em poliestireno transparente; PACOTE COM 10 UNIDADES
100Unidade
Produto/Serviço: PIPETA SOROLOGICA GRADUADA COM CAPACIDADE DE 25 ML, graduação 1/10, estéril, não pirogênico, embalada separadamente; Fabricada em poliestireno transparente; PACOTE COM 10 UNIDADES
Descrição: PIPETA SOROLOGICA GRADUADA COM CAPACIDADE DE 25 ML, graduação 1/10, estéril, não pirogênico, embalada separadamente; Fabricada em poliestireno transparente; PACOTE COM 10 UNIDADES
50Unidade


703/2020
17/02/2020 17:00:00
Processo Seletivo Simplificado
1/2020 Contratação de Outros Serviços
Edital

Produto/ServiçoQuant.Unidade
Produto/Serviço: Contratação de Pessoa Física para o Cargo de Técnico de nível V - Atletismo.
Descrição: Contratação de Pessoa Física para o Cargo de Técnico de nível V - Atletismo. As inscrições serão realizadas no período 20 a 31 de Janeiro de 2020 das 09:00 às 11:00h de segunda à sexta-feira (exceto sábado, domingo e feriado), na Fundação de Apoio ao Ensino, Pesquisa e Extensão – FEPE, situada na Avenida Presidente Antônio Carlos, 6627, SubSolo da Escola de Veterinária da UFMG, Pampulha, Belo Horizonte/MG.
1Unidade


798/2020
22/01/2020 16:00:00
Dispensa de licitação
41/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Pistola de limpeza corpo em alumínio 1/4 NPT
Descrição: 01 Pistola de limpeza corpo em alumínio 1/4 NPT acionamento por gatilho para ar comprimido ref. VONDER PL-7 ou VD-7.
1Unidade
Produto/Serviço: Filtro de ar coalescente de 1/4 BSP
Descrição: 01 Filtro de ar coalescente de 1/4 BSP copo em policarbonato ref. WERK SHOTT 21-F255.
1Unidade
Produto/Serviço: Pressostato automático baixa pressão 80/120 4 vias
Descrição: 01 Pressostato automático baixa pressão 80/120 4 vias ref. LEFOO
1Unidade
Produto/Serviço: Dreno ( purgador ) rosca 1/4 NPT
Descrição: 01 Dreno ( purgador ) rosca 1/4 NPT para compressor
1Unidade
Produto/Serviço: Niples 1/4 NPT
Descrição: 02 Niples 1/4 NPT
2Unidade
Produto/Serviço: Válvula de alívio 1/4 NPT para compressor de 175PSI
Descrição: 01 Válvula de alívio 1/4 NPT para compressor de 175PSI
1Unidade
Produto/Serviço: Litros de óleo para compressor a pistão
Descrição: 02 Litros de óleo para compressor a pistão
2Litro


800/2020
20/01/2020 16:00:00
Dispensa de licitação
43/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Caixa Criopreservação 100 Criotubos/Microtububos de 1,5/2,0ml com tampa dobradiça. Caixa em polipropileno extra-forte, para armazenamento de amostras contidas em microtubos (tipo Eppendorf) ou tubos criogênicos, em geladeira ou freezer -80C, autoclavávei
Descrição: Caixa Criopreservação 100 Criotubos/Microtububos de 1,5/2,0ml com tampa dobradiça. Caixa em polipropileno extra-forte, para armazenamento de amostras contidas em microtubos (tipo Eppendorf) ou tubos criogênicos, em geladeira ou freezer -80C, autoclaváveis.
10Unidade
Produto/Serviço: rack estante para suporte e armazenamento microtubos de PCR ou 96 Microtubos de 0,2 a 0,5 ml em polipropileno, autoclavável, com tampa dobradiça
Descrição: rack estante para suporte e armazenamento microtubos de PCR ou 96 Microtubos de 0,2 a 0,5 ml em polipropileno, autoclavável, com tampa dobradiça
10Unidade


804/2020
20/01/2020 16:00:00
Dispensa de licitação
47/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Suporte para Micropipetas monocanais: Suporte (Rack) vertical inclinado para acomodar até 5 micropipetas monocanais de diversas marcas existentes no mercado; Fabricado em acrílico transparente.
Descrição: Suporte para Micropipetas monocanais: Suporte (Rack) vertical inclinado para acomodar até 5 micropipetas monocanais de diversas marcas existentes no mercado; Fabricado em acrílico transparente.
1Unidade


806/2020
20/01/2020 16:00:00
Dispensa de licitação
49/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Gás para condicionador de ar - R22
Descrição: Garrafa de fás para ar condicionado. R22.
2Frasco


948/2020
20/01/2020 16:00:00
Dispensa de licitação
52/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ar condicionado
Descrição: Ar Condicionado Split 12.000 BTUs Frio - Tipo do Condensador - Axial Frontal
1Unidade


1031/2020
20/01/2020 16:00:00
Dispensa de licitação
53/2020 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Ração para ratos e camundongos Nuvilab CR-1
Descrição: Ração para ratos e camundongos Nuvilab CR-1, saco com 20kg
5Saco
Produto/Serviço: maravalha
Descrição: maravalha
5Saco


1125/2020
21/01/2020 16:00:00
Dispensa de licitação
55/2020 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ESCADA
Descrição: ESCADA multiuso de aluminio 12 degraus- carga: 200 kg
1Unidade


1168/2020
22/01/2020 16:00:00
Dispensa de licitação
56/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AGUA PARA INJEÇAO AMPOLA C/ 10 ML
Descrição: AGUA PARA INJEÇAO AMPOLA C/ 10 ML. REGISTRO ANVISA/MS. NOME DO RESPONSÁVEL TÉCNICO. PRAZO DE VALIDADE DE NO MÍNIMO 75% DA ESPECIFICADA NO RÓTULO.
4000Ampola


1171/2020
21/01/2020 16:00:00
Dispensa de licitação
57/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Celer AFLA ELISA Kit 96 determinações
Descrição: Celer AFLA ELISA Kit 96 determinações (MA210) Pontos curva de calibração: 0, 2, 8, 30, 80 ppb
1Kit
Produto/Serviço: Celer DON ELISA Kit 96 determinações
Descrição: Celer DON ELISA Kit 96 determinações (MD100) Pontos curva de calibração: 0, 40, 250, 1250, 5000 ppb
1Kit
Produto/Serviço: Celer FUMO ELISA Kit 96 determinações
Descrição: Celer FUMO ELISA Kit 96 determinações (MF100) Pontos curva de calibração: 0, 750, 4000, 20000, 60000 ppb
1Kit
Produto/Serviço: Celer OCHRA ELISA Kit 96 determinações
Descrição: Celer OCHRA ELISA Kit 96 determinações (OR370) Pontos curva de calibração: 0, 2, 5, 25, 50 ppb
1Kit


1234/2020
21/01/2020 16:00:00
Dispensa de licitação
58/2020 Equipamentos/Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Cabo de Força
Descrição: Cabo de força PC. Monitor - Novo padrão - conector 2P+T - 1,5m de comprimento - padrão NBR 14136
12Unidade


1236/2020
21/01/2020 16:00:00
Dispensa de licitação
60/2020 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Desinfetante concentrado
Descrição: Desinfetante concentrado, limpador, constituído com agentes bactericidas, detergente biodegradável, agentes sequestrantes, antioxicidante, promovendo a desinfecção e desodorização da superfície onde é aplicado, controlando os maus odores provenientes da matéria orgânica decomposta por micro-organismos, a base de cloreto de benzalconio e essência floral, talco ou eucalipto , com diluição de 1:10 bactericida, 1:50 bacteriostático e 1:20 odorizante, embalado em galão plástico contendo 5 litros, com tampa que não permita vazamento. , com número de registro do produto na ANVISA
10Galão
Produto/Serviço: Sabão Neutro Liquido
Descrição: Sabão Neutro Liquido para higienização de piso concentrado com alto poder de limpeza, veículo, tensoativo aniônico, metassilicato de sódio, espessante, tensoativo não iônico, fragrância agradável e ph neutro. Embalado em galão de 5 litros (10 galões / Total 50 litros) contendo externamente os dados de identificação, procedência, número do lote, validade e número de registro no Ministério da Saúde.
10Galão
Produto/Serviço: Vassoura Metálica 22 Dentes Rastelo
Descrição: Vassoura Metálica 22 Dentes Rastelo - Sem Cabo -
10Unidade
Produto/Serviço: Detergente
Descrição: Detergente - Embalado em galão de 5 litros contendo externamente os dados de identificação, procedência, número do lote, validade e número de registro no Ministério da Saúde
10Galão
Produto/Serviço: Baldes de 9 litros
Descrição: BALDE de PLASTICO, 9 LITROS, M ALUMÍNIO 28 CM DE DIÂMETRO X 27 CM ALTURA
10Unidade
Produto/Serviço: Rodo Grande de inox
Descrição: Rodo Grande de inox com cabo de madeira com rosca, suporte plástico medindo de 60 cm,
5Unidade
Produto/Serviço: Vassoura piaçava
Descrição: Vassoura piaçava, madeira, 20 cm de largura, com cabo rosqueado. Vassoura de piaçava com cabo de madeira fixado ao taco e este ao corpo através do revestimento com folha de flandres. . CABO madeira resistente e com formato cilíndrico, deverá ser lixado, isento de nós, superfície lisa, sem qualquer forma pontiaguda, tendo ainda a ponta superior arredondada e a outra firmemente presa ao taco. TACO madeira com furação central lisa ou roscada para receber o cabo que deverá ficar rigidamente preso. CORPO madeira com formato trapezoidal adequado para receber os fios de piaçava que deverão ser distribuídos entre este e o taco. PIAÇAVA selecionada e beneficiada. Os fios deverão ser contínuos e com rigidez adequada para varrição de piso áspero. Não serão aceitos fios provenientes de crina vegetal tingida. REVESTIMENTO do conjunto taco corpo e piaçava deverá ser feito com folha de flandres litografada ou lisa sem oxidação ou rebarbas, podendo ser pregado ou grampeado.
10Unidade


1237/2020
21/01/2020 16:00:00
Dispensa de licitação
61/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Álcool etílico absoluto 99,5°
Descrição: Álcool etílico absoluto 99,5°
100Litro


1238/2020
21/01/2020 16:00:00
Dispensa de licitação
62/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: FLORFENICOL 30G/100ML -SOLUÇÃO INJETÁVEL, FRASCO-AMPOLA COM 100ML
Descrição: FLORFENICOL 30G/100ML- SOLUÇÃO INJETÁVEL, FRASCO-AMPOLA C/ 100ML. RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, LICENCIADO NO MAPA. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO.
6Frasco


1239/2020
21/01/2020 16:00:00
Dispensa de licitação
63/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Acetato de sódio
Descrição: Acetato de sódio
5Quilograma
Produto/Serviço: GLICOSE DE MILHO
Descrição: GLICOSE DE MILHO
20Quilograma
Produto/Serviço: Soro Ringer Lactado 500ml
Descrição: Soro Ringer Lactado 500ml
60Frasco
Produto/Serviço: Cateter intravenoso
Descrição: Cateter intravenoso 18G
30Unidade
Produto/Serviço: equipo macrogotas
Descrição: equipo macrogotas
30Unidade
Produto/Serviço: Furadeira
Descrição: Furadeira
1Peça


1240/2020
21/01/2020 16:00:00
Dispensa de licitação
64/2020 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: microtubo tipo eppendorf 1,5ml clear com 500 unid
Descrição: microtubo tipo eppendorf 1,5ml clear baixa retenção, low retention , com 500 unid
6Saco


1323/2020
22/01/2020 16:00:00
Dispensa de licitação
65/2020 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Mamadeira
Descrição: Mamadeira Plástica Para Bezerros 2 litros
4Unidade


1365/2020
22/01/2020 16:00:00
Dispensa de licitação
67/2020 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Cepravin
Descrição: COMPRA DE 02 CAIXAS DE CEPRAVIN VACA SECA PARA SETOR DE BOVINOS.
2Caixa