ÁREA DO FORNECEDOR

ACESSO RESTRITO












Destaques


A FEPE recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
15275/2016
12/06/2018 16:00:00
Formulários Aplicáveis à UFMG
1/2016 Outras Compras
FICHA DE GESTÃO

Produto/ServiçoQuant.Unidade
Produto/Serviço: Formulários Aplicáveis à UFMG
Descrição: Formulários Aplicáveis à UFMG
1Unidade


9727/2018
30/05/2018 16:00:00
Dispensa de licitação
347/2018 Contratação de Outros Serviços
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: manutenção preventiva
Descrição: Manutenção e reformas das gaiolas metabólicas Recuperação de soldagem e pintura das gaiolas metabólicas, necessário visita na instalação para a elaboração do orçamento.
20Unidade


14030/2018
30/05/2018 08:00:00
Dispensa de licitação
528/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Anti-Tumor Necrosis Factor antibody
Descrição: Anti-Tumor Necrosis Factor antibody (N-Term)
1Kit
Produto/Serviço: Anti-IL1B antibody
Descrição: Anti-IL1B antibody (Interleukin 1, beta) (AA 118-268)
1Kit
Produto/Serviço: Anti-Platelet Derived Growth Factor AA - ANTIBODY
Descrição: Anti-Platelet Derived Growth Factor AA - ANTIBODY
1Kit


14437/2018
30/06/2018 00:00:00
Processo Seletivo Simplificado
8/2018 Contratação de Outros Serviços
Auxiliar de Farmacia
Resultado de titulos
Resultado entrevista
Resultado Final

Produto/ServiçoQuant.Unidade
Produto/Serviço: Contratação de Pessoa Física
Descrição: Processo Seletivo simplificado. Inscrições: No período de 23 a 27 de abril de 2018, das 09:00 ás 11:00h de segunda a sexta feira, na Fundação de Apoio ao Ensino, Pesquisa e Extensão -FEPE, situada na Avenida Presidente Antônio Carlos,6627, 2° Andar, Escola de Veterinária da UFMG, Pampulha, Belo Horizonte/MG. Contratação de Pessoa Física: 01 vaga para Auxiliar de Farmácia. Jornada de Trabalho CLT: 12X36 -10h as 22h. Salário Mensal: R$ 1.146,046. Ticket Alimentação: R$440,00. Vale Transporte: de acordo com o endereço residencial. Insalubridade: 40% do salário mínimo vigente.
1Unidade


15045/2018
29/05/2018 16:00:00
Dispensa de licitação
572/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Micropipeta multicanal de 8 canais, de volume variável (20 a 200 microlitros)
Descrição: Serviço de manutenção em micropipeta multicanal de 8 canais, de volume variável (20 a 200 microlitros), com troca dos o´rings internos e externos.
1Unidade
Produto/Serviço: Micropipeta monovolume de volume variável (100 a 1000 microlitros)
Descrição: Serviço de manutenção em micropipeta monovolume de volume variável (100 a 1000 microlitros), para colocação de ejetor de ponteiras.
1Unidade
Produto/Serviço: Pipetador eletrônico de 1 a 100 ml
Descrição: Serviço de manutenção e conserto de pipetador eletrônico de 1 a 100 ml, bivolt, para conserto do mecanismo eletrônico.
1Unidade
Produto/Serviço: Pipetador eletrônico de 1 a 100 ml
Descrição: Serviço de manutenção e troca de peça de pipetador eletrônico de 1 a 100 ml, bivolt, para troca do adaptador para pipetas de silicone.
1Unidade


16559/2018
29/05/2018 16:00:00
Dispensa de licitação
642/2018 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Camisa polo em malha piquet com 01 bordado conforme arte a ser enviada.
Descrição: Camisa polo de acordo com modelos e tamanhos descritos a seguir: Baby look tamanho P = 1 Baby look tamanho GG = 4 Polo tamanho P = 1 Polo tamanho M = 2 Polo tamanho G = 2
10Unidade


16750/2018
31/05/2018 16:00:00
Dispensa de licitação
645/2018 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Material de Consumo
Descrição: Livros, obras de suporte, referências metodológicas e dicionários técnicos importados Manuale di diritto internazionale privato di Giorgio Conetti, Sara Tonolo, Fabrizio Vismara Disponibilità immediata Editore: Giappichelli Edizione: 3 Data di Pubblicazione: settembre 2017 EAN: 9788892109896 ISBN: 8892109898 Pagine: XVIII-301 Formato: brossura Ean altre edizioni: 9788834888261
1Unidade
Produto/Serviço: Material de Consumo
Descrição: Livros, obras de suporte, referências metodológicas e dicionários técnicos importados Diritto dell'internet. Manuale operativo. Casi, legislazione, giurisprudenzadi Autores G. Cassano, G. Scorza, G. Vaciago (a cura di) Editore:CEDAMA 2012 EAN:9788813329341 ISBN:8813329342 Pagine:908Formato:brossura
1Unidade
Produto/Serviço: Material de Consumo
Descrição: Livros, obras de suporte, referências metodológicas e dicionários técnicos importados Diritto di Internet Autora: Giusella Finocchiaro Editore: Zanichelli Edizione: 2 Data di Pubblicazione: settembre 2008 EAN: 9788808063557 ISBN: 8808063550 232p.
1Unidade
Produto/Serviço: Material de Consumo
Descrição: Livros, obras de suporte, referências metodológicas e dicionários técnicos importados Diritto privato dell'informatica e di Internet. I beni, i contratti, le responsabilità Emilio Tosi (Autore) 795 pagine Editore: Giuffrè; 1 edizione (1 dicembre 2006) Lingua: Italiano ISBN-10: 8814125945 ISBN-13: 978-8814125942
1Unidade
Produto/Serviço: Material de Consumo
Descrição: Livros, obras de suporte, referências metodológicas e dicionários técnicos importados La governance di Internet fra autoregolazione, sovranità statale e diritto internazionale Autor: Alberto Oddenino 2008 - pp. 204 formato cartaceo - ISBN 978•88•3488558•1
1Unidade
Produto/Serviço: Material de Consumo
Descrição: Livros, obras de suporte, referências metodológicas e dicionários técnicos importados Istituzioni di diritto internazionale 2016- pp. XXXIV-614 ISBN 978•88•9210525•6
1Unidade
Produto/Serviço: Material de Consumo
Descrição: Livros, obras de suporte, referências metodológicas e dicionários técnicos importados Internet e Costituzione AA.VV. edited by Michele Nistico' - Paolo Passaglia Atti del Convegno. Pisa, 21-22 novembre 2013 Collana del Dipartimento di Giurisprudenza dell'Università di Pisa 2014- pp. X-374 € 42,00 - ISBN 978•88•3484764•0
1Unidade
Produto/Serviço: Material de Consumo
Descrição: Livros, obras de suporte, referências metodológicas e dicionários técnicos importados Diritto internazionale privato e processuale vol.1 Parte generale e obbligazioni di Franco Mosconi, Cristina Campiglio Editore: Utet Giuridica Edizione: 8 Data di Pubblicazione: luglio 2017 EAN: 9788859815747 ISBN: 8859815746 Formato: brossura Ean altre edizioni: 9788859805045, 9788859810049, 9788859813255
1Unidade


16949/2018
26/05/2018 00:00:00
Dispensa de licitação
668/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: primers - Oligonucleotideos
Descrição: Materiais para PCR (agarose, primers, master mix para PCR em tempo real, Taq, dNTP, etc...)
2Unidade


17173/2018
30/05/2018 09:00:00
Dispensa de licitação
679/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ELISA C. difficile toxin A/B - 96 poços
Descrição: ELISA (teste imunoenzimático) comercial para detecção das toxinas A/B de C. difficile. Atualmente o kit é produzido por 3 empresas, a saber, TechLab, Thermo Scientific - Oxoid e R-Biopharm. As especificações de cada um kits encontram-se nos documentos anexos a frente.
2Caixa


17175/2018
29/06/2018 16:00:00
Dispensa de licitação
681/2018 Contratação de Outros Serviços
Editap para portador de deficiencia
Prorrogação

Produto/ServiçoQuant.Unidade
Produto/Serviço: Contratação de Pessoa Física
Descrição: Processo Seletivo para Contratação de Pessoas Portadoras de Deficiência e/oi Reabilitadas pelo INSS. Cargo: Arquivista. Carga Horária: 20 Horas Semanais. Salário: R$ 600,00. Inscrição no período de 02 a 04 e 07 a 09 de maio de 2018, das 9: 00 as 11:00h, de segunda a sexta feira, na Fundação de Apoio ao Ensino, Pesquisa e Extensão -FEPE, situada na Avenida Antônio Carlos,6627,2° Andar, Escola de Veterinária da UFMG, Pampulha, Belo Horioznte/MG
1Unidade


17889/2018
31/05/2018 16:00:00
Pregão eletrônico
127/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: MANTA SMS 1,20 X 1,20 CM
Descrição: MANTA SMS 1,20 X 1,20 CM – Manta em SMS 100% polipropileno, 3 camadas, própria para esterilização de artigos médico-hospitalares, gramatura mínima de 60g/m². Alta barreira bacteriana. Total: 400 FOLHAS de SMS
400Unidade


17892/2018
31/05/2018 16:00:00
Importação
2/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Ergometro de braço
Descrição: Ergometria de braço ANGIO CPET completo com Unidade de Controle 7"
1Unidade


18242/2018
29/05/2018 16:00:00
Dispensa de licitação
721/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Iodo
Descrição: Iodo 10%
3Litro
Produto/Serviço: Álcool
Descrição: Álcool 96%
5Litro
Produto/Serviço: algodão
Descrição: algodão
1Pacote
Produto/Serviço: biocid
Descrição: Biocid
4Litro
Produto/Serviço: Knetomax 100 ml
Descrição: Knetomax 100 ml
15Unidade
Produto/Serviço: Ganaseg 30 ml
Descrição: Ganaseg 30 ml
10Unidade


18614/2018
29/05/2018 16:00:00
Dispensa de licitação
740/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: 1 pacote com 500 embalagens em SMS AZUL 50X50cm para esterilização
Descrição: SMS AZUL 50X50cm para esterilização "LEVE" pacote com 500 embalagens
1Pacote
Produto/Serviço: 1 pacote com 500 embalagens em SMS AZUL 40X40cm para esterilização
Descrição: 1 pacote com 500 embalagens em SMS AZUL 40X40cm para esterilização "LEVE"
1Pacote


18912/2018
29/05/2018 16:00:00
Dispensa de licitação
757/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SOLUÇÃO DE GLICERINA 12% - FRASCO C/ 500 ML
Descrição: SOLUÇÃO DE GLICERINA 12% - FRASCO C/ 500 ML (ENEMA) REGISTRO NO MAPA/MS. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA NA FARMÁCIA
48Frasco
Produto/Serviço: SOLUÇÃO DE BICARBONATO DE SÓDIO 8,4% - FRASCO DE 250 ML
Descrição: SOLUÇÃO DE BICARBONATO DE SÓDIO 8,4% - FRASCO DE 250 ML. MEDICAMENTO COM REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA.
48Frasco


19381/2018
29/05/2018 16:00:00
Dispensa de licitação
776/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ração
Descrição: Ração e ingredientes para alimentação de tilápias: 1 saco de 25 kg de sal comum moído - NaCl;
1Saco
Produto/Serviço: Sacos de 25 kg de sal comum moído
Descrição: Material de manejo de peixe. 19 Sacos de 25 kg de sal comum moído - NaCl;
19Saco
Produto/Serviço: Fitilho (barbante) plástico
Descrição: Materiais para sistema de aeração: Fitilho (barbante) plástico para Amarrações de pesos para aeração. Rolo com 1 kg
3Rolo
Produto/Serviço: Arame Galvanizado Plastificado
Descrição: Materiais para sistema de aeração. Arame Galvanizado Plastificado - Arame BWG 18 (2,00mm) Revestimento em PVC super aderente Vendido no peso (kg) – aproximadamente 90,0 metros/kg
3Quilograma
Produto/Serviço: Kit Membranas para AK87 / AK88
Descrição: Kit Membranas para AK87 / AK88 Kit com 5 unidades
2Kit
Produto/Serviço: União Interna de 1/2" para mangueiras flexíveis
Descrição: União Interna de 1/2" para mangueiras flexíveis e tubos de polietileno; Produzido em PP (Polipropileno). Instalação através de simples encaixa por travamento por espigão, dispensa o uso de ferramentas.
50Unidade
Produto/Serviço: Joelho Interno Duplo de 1/2"
Descrição: Material hidráulico: Joelho Interno Duplo de 1/2" Para mangueiras flexíveis e tubos de polietileno; Produzido em PP (Polipropileno).
25Unidade
Produto/Serviço: Adaptador Interno com Rosca Externa de 1/2"
Descrição: Material hidráulico: Adaptador Interno com Rosca Externa de 1/2" Para mangueiras flexíveis e tubos de polietileno; Produzido em PP (Polipropileno).
25Unidade
Produto/Serviço: Cap Branco PVC Roscável 20mm ou 1/2"
Descrição: Material hidráulico: Cap Branco PVC Roscável 20mm ou 1/2"
25Unidade
Produto/Serviço: MANGUEIRA RECAPADA AZUL/VERDE 1/2"X2,0MM 5
Descrição: Material de manejo de peixe. MANGUEIRA RECAPADA AZUL/VERDE 1/2"X2,0MM 50 METROS Medidas: 1/2x2,0" Dupla camada de PVC Flexível 2 Rolos com 50,0 metros cada.
2Rolo
Produto/Serviço: Termostato.
Descrição: Material de manejo de peixe: material para manutenção de temperatura adequada. Termostato. Modelo é o tic 17S que é o modelo de sobrepor. Especificações técnicas: Alimentação direta: - Temperatura de Controle: - Resolução: - Corrente máxima: - Dimensões: : - Temperatura de operação: Umidade de operação: 115 ou 230 Vac (50/ 60 Hz) 12 ou 24Vac/dc -50 a 105 ºC 0.1ºC (entre -10 e 100 ºC) e 1 ºC no restante da faixa 16 Amperes (carga resistiva) - Atenção a este detalhe porque alguns modelos são de 10A. TIC-17S: 76 x 60 x 38 mm 0 a 60 ºC - 10 a 90% UR (sem condensação)
4Unidade


19561/2018
30/05/2018 00:00:00
Dispensa de licitação
789/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Cabo Empire SVGA DB15 M x D815 M com filtro de 10 M Gold W309.010 - 1536
Descrição: Cabo Empire SVGA DB15 M x D815 M com filtro de 10 M Gold W309.010 - 1536
1Unidade
Produto/Serviço: Cabo Vinik 1 VGA Macho x 2 VGA Fêmea 15 pinos AVY-1M/2F 23544
Descrição: Cabo Vinik 1 VGA Macho x 2 VGA Fêmea 15 pinos AVY-1M/2F 23544
2Unidade
Produto/Serviço: Empire Cabo HDMI 1.4 TV 3D M/M 10 metros W207.510 - 1533
Descrição: Empire Cabo HDMI 1.4 TV 3D M/M 10 metros W207.510 - 1533
1Unidade
Produto/Serviço: Suporte articulado de parede ELG LCD/plasma/led/3D de 26' a 55' Full40
Descrição: Suporte articulado de parede ELG LCD/plasma/LED/3D de 26' a 55' Full40
1Unidade


19562/2018
26/05/2018 16:00:00
Dispensa de licitação
790/2018 Material de construção
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Tijolo
Descrição: Fornecimento de Tijolo cerâmico furado, classe 10 de resistência à compressão, conforme NBR 15270/2005 e seus documentos complementares, com as dimensões: 09 x 19 x 29 cm.
500Unidade


19563/2018
31/05/2018 16:00:00
Dispensa de licitação
791/2018 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Cadeira de caixa
Descrição: Cadeira de caixa: com espuma de alta densidade, estrutura giratória, altura do assento até o chão (máx) 68 cm e (min) 58 cm, sistema de regulagem de altura a gás, aro em aço para apoio dos pés, regulagem de encosto, sem braços, sem rodízios nos pés, cor preta
2Unidade
Produto/Serviço: Cadeira para escritorio secretaria
Descrição: Cadeira para escritório secretaria, com espuma de alta densidade, estrutura giratória, sistema de regulagem de altura a gás "L" sanfonado no encosto e rodízios, altura do assento até o chão (max) 55 cm e (mim) 45 cm, sem braços, cor preta
1Unidade


19566/2018
30/05/2018 16:00:00
Dispensa de licitação
792/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CLORIDRATO DE PROXIMETACAÍNA 0,5% - SOLUÇÃO OFTÁLMICA ESTÉRIL
Descrição: CLORIDRATO DE PROXIMETACAÍNA 0,5% - SOLUÇÃO OFTÁLMICA ESTÉRIL (ANESTALCON) REGISTRO NA ANVISA/MS. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA.
10Frasco
Produto/Serviço: TOBRAMICINA SOLUÇÃO OFTÁLMICA 0,3% - FRASCO C/ 5ML
Descrição: TOBRAMICINA SUSPENSÃO 0,3% - FRASCO C/ 5ML VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DA ENTREGA NA FARMÁCIA.
10Frasco


19576/2018
31/05/2018 16:00:00
Pregão eletrônico
138/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: COMPRESSA CIRÚRGICA, CAMPO OPERATÓRIO 45X50, DESCARTÁVEL, ESTÉRIL, PACOTE COM 5 UNIDADES (PE 005/2017- DIFARMIG)
Descrição: COMPRESSA CIRÚRGICA, CAMPO OPERATÓRIO 45X50, DESCARTÁVEL, ESTÉRIL, PACOTE COM 5 UNIDADES
1200Pacote


19833/2018
26/05/2018 16:00:00
Dispensa de licitação
815/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CEFALOTINA 1G - DILUICAO P/ 5ML - PÓ LIOFILIZADO
Descrição: CEFALOTINA 1G - DILUICAO P/ 5ML - PO LIOFILIZADO MEDICAMENTO COM REGISTRO NA ANVISA. VALIDADE DE NO MÍNIMO 1 ANO APOS ENTREGA NA FARMÁCIA.
400Frasco


20025/2018
26/05/2018 16:00:00
Dispensa de licitação
820/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: GLUCONATO DE CÁLCIO 10% AMPOLA C/ 10 ML AMP
Descrição: GLUCONATO DE CÁLCIO 10% AMPOLA C/ 10 ML Medicamento manipulado
100Unidade


20028/2018
29/05/2018 16:00:00
Pregão eletrônico
141/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: SERINGA DESCARTÁVEL 0,5ML (ULTRA FINE) COM AGULHA CURTA (8 X 0,30MM) (PE 005/2017)
Descrição: SERINGA DESCARTÁVEL 0,5ML (ULTRA FINE) COM AGULHA CURTA (8 X 0,30MM), caixa com 100 unidades
600Unidade


20029/2018
30/05/2018 16:00:00
Dispensa de licitação
822/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CLORIDRATO DE FENILEFRINA 10MG/ML, SOLUÇÃO INJETÁVEL, AMPOLA COM 1ML
Descrição: CLORIDRATO DE FENILEFRINA 10MG/ML, SOLUÇÃO INJETÁVEL, AMPOLA COM 1ML. REGISTRO NA ANVISA. VALIDADE DE NO MÍNIMO 1 ANO NO MOMENTO DE ENTREGA NA FARMÁCIA.
50Ampola


20030/2018
27/05/2018 17:00:00
Dispensa de licitação
823/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: AMICACINA 250 MG/ML - SOLUÇÃO INJETÁVEL AMPOLA C/ 2 ML, CAIXA COM 50 AMPOLAS
Descrição: AMICACINA 250 MG/ML - SOLUÇÃO INJETÁVEL AMPOLA C/ 2 ML, CAIXA COM 50 AMPOLAS.RÓTULO CONTENDO ESPECIFICAÇÃO DO PRODUTO, IDENTIFICAÇÃO DO FABRICANTE, LOTE, DATA DE FABRICAÇÃO, PRAZO DE VALIDADE, COMPOSIÇÃO, RESPONSÁVEL TÉCNICO, REGISTRO NA ANVISA/MS. VALIDADE DO PRODUTO DEVE SER DE NO MÍNIMO 01 ANO NA DATA DA ENTREGA NA INSTITUIÇÃO.
3Caixa


20273/2018
29/05/2018 16:00:00
Dispensa de licitação
824/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Adaptador de USB-C Apple, para Novo MacBook, VGA Multiporta.
Descrição: Equipamento. Adaptador de USB-C Apple, para Novo MacBook, VGA Multiporta.
1Unidade


20275/2018
30/05/2018 16:00:00
Dispensa de licitação
825/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Oligonucleotideos (primers) 25 nmol
Descrição: adhP F GTTGGTCATGGTGAAGCACT adhP R ACTGTACCTCCAGCACGAAC pheS F GATTAAGGAGTAGTGGCACG pheS R TTGAGATCGCCCATTGAAAT atr F CGATTCTCTCAGCTTTGTTA atr R AAGAAATCTCTTGTGCGGAT glnA F CCGGCTACAGATGAACAATT glnA R CTGATAATTGCCATTCCACG sdhA F AGAGCAAGCTAATAGCCAAC sdhA R ATATCAGCAGCAACAAGTGC glcK F CTCGGAGGAACGACCATTAA glcK R CTTGTAACAGTATCACCGTT tkt F CCAGGCTTTGATTTAGTTGA tkt R AATAGCTTGTTGGCTTGAAA Irido 1-F 5'-CTC-AAA-CAC-TCT-GGC-TCA-TC-3' Irido 1-R 5'-GCA-CCA-ACA-CAT-CTCCTA-TC-3' Beta OPVP75 5'-CGT-GTC-GGT-GCT-GTG-TCG-CT-3' Beta R3 5'-CGA-GTC-AAC-ACG-GGT-GAA-GA-3' Tilv Nested ext-2 5'-TTG-CTC-TGA-GCA-AGA-GTA-CC-3' Tilv Nested ext-1 5'-TAT-GCA-GTA-CTT-TCCCTG-CC-3' ß-actin _F 5'-TCC-AAT-TTA-TTG-GCC-TTC-GTT-GC-3' ß-actin _R 5'-CTT-CCA-TTT-TCT-GTG-TGA-GGG-AGG-3' fish-dys-sodA F 5'-ATGCGACTTATGTTGCCA-3' fish-dys-sodA R 5'- GTGTATCTTGATTCGCTG-3'
24Unidade


20404/2018
26/05/2018 16:00:00
Dispensa de licitação
831/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Kit para dosagem de IgG
Descrição: Kit para dosagem de IgG - Mouse AntiBovine CD4:RPE (código MCA1653PE)
1Kit
Produto/Serviço: Kit para dosagem de IgG -Mouse AntiBovine
Descrição: Kit para dosagem de IgG -Mouse AntiBovine CD8:Aesa Flúor 674 (código MCA837A647)
1Kit


20580/2018
30/07/2018 16:00:00
Processo Seletivo Simplificado
9/2018 Contratação de Outros Serviços
Ginastica Artistica

Produto/ServiçoQuant.Unidade
Produto/Serviço: Contratação de Pessoa Física
Descrição: Cargo: Professor Inscrições no período de 23 a 25 e de 28 a 30 de Maio de 2018 de 09:00 às 11:00 Hs de segunda a Sexta-feira, na Fundação de Apoio ao Ensino, Pesquisa e Extensão- FEPE, situada na Av. Presidente Antonio Carlos, 6627, 2° Andar, Escola de Veterinária da UFMG, Pampulha, Belo Horizonte.
4Unidade


20835/2018
29/05/2018 16:00:00
Dispensa de licitação
835/2018 Hospedagem
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Hospedagem
Descrição: Hospedagem para particpação no Grupo de trabalho de autismo no 17º Simpósio da ANPEPP a ser realizado entre 15 a 18 julho de 2018 na UniCEUB, em nome de Andrea Viera Zanella e Maria Luísa M. Nogueira. Standard Room with 2 singles. Período: check-in15/7 a 17/7/18 check-out
2Unidade


20836/2018
29/05/2018 16:00:00
Dispensa de licitação
836/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Mesa para anatomia em inox
Descrição: Mesa para anatomia, fabricada em inox com aproximadamente 90 x 190 x 70 cm (altura x comprimento x largura) com balde de alumínio e pés com regulagem para desnível de piso
1Unidade


20837/2018
29/05/2018 16:00:00
Dispensa de licitação
837/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: DEXAMETASONA 2MG/ML AMPOLA C/ 1ML
Descrição: DEXAMETASONA 2MG/ML AMPOLA C/ 1ML CAIXA COM 50 AMPOLAS. REGISTRO ANVISA. VALIDADE SUPERIOR A UM ANO NO MOMENTO DE ENTREGA NA FARMÁCIA
200Ampola


20838/2018
29/05/2018 16:00:00
Dispensa de licitação
838/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: ERITROPOETINA 400MG, PÓ LIÓFILO, FRASCO-AMPOLA
Descrição: ERITROPOETINA 400MG, PÓ LIÓFILO, FRASCO-AMPOLA
15Frasco


20842/2018
29/05/2018 16:00:00
Dispensa de licitação
839/2018 Produtos Agropecuários
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Bicarbonato de sódio
Descrição: 1 tonelada de bicarbonato de sódio para fábrica de rações.
1Tonelada


20845/2018
29/05/2018 16:00:00
Dispensa de licitação
842/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: 1 frasco de cinco gramas de BSA (Bovine Serum albumin) (A1933)
Descrição: 1 frasco de cinco grama de BSA (Bovine Serum albumin) (A1933)
1Frasco


20847/2018
30/05/2018 16:00:00
Dispensa de licitação
843/2018 Contratação de Outros Serviços
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: serviço manutenção microscópio
Descrição: serviço manutenção microscópios: 01 microscópio Olympus CBA 02 microscópios Nikon E-200 01 estereomicroscópio Nikon SMZ1000 Descrição dos serviços: Exame funcional do instrumento e dos módulos que os compõem. Desmontagem/montagem quando necessário do sistema mecânico (macro e micrométrico/condensador) para troca de lubrificantes e ajuste. Desmontagem/montagem da parte ótica, para limpeza, remoção de fungos e alinhamento. Limpeza e lubrificação dos movimentos contínuos de aumento. Controle de funcionamento.
1Unidade


20905/2018
29/05/2018 16:00:00
Dispensa de licitação
850/2018 Contratação de Outros Serviços
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Serviço calibração micropipeta variável monocanal, em três pontos de calibração (mínimo, 50% e máximo da capacidade) incluindo ajuste
Descrição: Serviço calibração micropipeta variável monocanal, em três pontos de calibração (mínimo, 50% e máximo da capacidade) incluindo ajuste, como segue: 03 Pipetas Monocanais GILSON PIPETMAN Classic - P10 (1 a 10 µl) PIPETMAN Classic - P20 (2 a 20 µl) PIPETMAN Classic - P100 (20 a 100 µl) 01 Pipeta Monocanal SELECT BIOPRODUCTS SelectPette - SBP100-1000 (100 a 1000 µl) 01 Pipeta Monocanal HTL LABMATE SOFT - LM10000 (1000 a 10000 µl) 02 Pipetas Monocanais RAININ RAININ Classic - PR 20 (2 a 20 µl) RAININ Classic - PR 200 (20 a 200 µl)
7Unidade
Produto/Serviço: Serviço calibração micropipeta variável multicanal, em três pontos de calibração (mínimo, 50% e máximo da capacidade) incluindo ajuste
Descrição: Serviço calibração micropipeta variável multicanal, em três pontos de calibração (mínimo, 50% e máximo da capacidade) incluindo ajuste, como segue: 01 Pipeta Multicanal RAININ Pipet-Lite™ XLS Multicanal - L8-300XLS (20-300 µl
1Unidade


20908/2018
29/05/2018 16:00:00
Dispensa de licitação
852/2018 Material de construção
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Selante incolor
Descrição: Selante incolor de silicone acético, com bactericida, densidade de 1,0kg/l, mono componente com bactericida (ação anti-mofo e anti-fungos), adere sobre alumínio, vidro, porcelana, mármore, plástico etc., possui uma grande flexibilidade e resistência à água, à umidade e às variações de temperatura, embalagem aproximadamente de 280 a 310 gramas (cartucho), características técnicas: borracha de silicone acético de vulcanização em temperatura ambiente, estado físico sólido, cor incolor, odor característico de ácido acético, cura total em 24 horas, formação de película em 30 minutos, insolúvel em água, não explosivo. Validade mínima de 6 meses na data de entrega na obra.
40Unidade


20909/2018
29/05/2018 16:00:00
Dispensa de licitação
853/2018 Equipamentos/Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Impressora térmica Zebra GC420T (GC420-1005A0-000)
Descrição: Impressora térmica Zebra GC420T (GC420-1005A0-000).
1Unidade


20910/2018
29/05/2018 16:00:00
Dispensa de licitação
854/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: LOMUSTINA 40 MG, CÁPSULA
Descrição: LOMUSTINA 40MG, CÁPSULA. REGISTRO MS/ANVISA VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE DO PRODUTO.
50Comprimido
Produto/Serviço: LOMUSTINA 10MG, CÁPSULA
Descrição: LOMUSTINA 10MG, CÁPSULA REGISTRO MS/ANVISA VALIDADE DE NO MÍNIMO 75% DO PRAZO DE VALIDADE DO PRODUTO
50Comprimido


20913/2018
29/05/2018 16:00:00
Dispensa de licitação
856/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Caixa contendo LAMÍNULA DE VIDRO - 24 X 50 MM - 100 UNID
Descrição: Caixa contendo LAMÍNULA DE VIDRO - 24 X 50 MM - 100 UNID
10Unidade
Produto/Serviço: CAIXA DE NAVALHA PARA MICRÓTOMO ALTO PERFIL - 50 UNID - DURA EDGE
Descrição: CAIXA DE NAVALHA PARA MICRÓTOMO ALTO PERFIL - 50 UNID
3Caixa
Produto/Serviço: LAMINA 26X76MM FOSCA LAPIDADA CX/50 PECAS
Descrição: LAMINA 26X76MM FOSCA LAPIDADA CX/50 PECAS
10Unidade


20937/2018
29/05/2018 16:00:00
Dispensa de licitação
857/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: telefone
Descrição: Aparelho de telefone sem fio - Especificações: Tecnologia DECT 6.0 (1,910 1,920 GHz) Identificação de chamadas DTMF e FSK Display alfanumérico, não luminoso Capacidade para até 7 ramais (base + 6 ramais) Agenda para 70 nomes/números Discagem rápida para 10 números (teclas 0 - 9) Bloqueio de teclado Som de teclado (on/off) Registro de 15 chamadas atendidas, 20 chamadas não atendidas e 15 realizadas (com data, hora e nome, se cadastrado na agenda) Bloqueio de discagem com uso de senha Data e hora e despertador Pre dialing Cadeado Atendimento programável (ao retirar o fone da base ou tecla liga) 4 opções de volume de toque + silencioso 7 tipos de toque 3 opções de volume de recepção de áudio Menu trilíngue em português, espanhol e inglês Indicador de carga de bateria (ícone no display) Temporização de chamadas Duração da chamada (cronômetro) Código de área Flash programável Tom/Pulso Funções flash, redial e mute Tecla Intercom (intercomunicação entre ramais) Comunicação interna, transferência e conferência entre ramais (somente entre fones da família TS 40 e TS 60) Teclas liga e desliga (definição de design) LED no fone LED na base (carregando e em uso) Page (localizador) na base Fonte de alimentação 7,5 V/300 mA Dimesões: Altura: 9 cm Largura: 13 cm Profundidade: 17,2 cm Peso: 0,400 kg Garantia do fornecedor de 12 meses
1Unidade


21001/2018
29/05/2018 16:00:00
Dispensa de licitação
859/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Serviço calibração micropipeta variável monocanal, em três pontos de calibração (mínimo, 50% e máximo da capacidade) incluindo ajuste
Descrição: Serviço calibração micropipeta variável monocanal, em três pontos de calibração (mínimo, 50% e máximo da capacidade) incluindo ajuste, como segue: 01 Pipeta Monocanal HTL LABMATE+ - LM1000 (100 a 1000 µl)
1Unidade


21004/2018
29/05/2018 16:00:00
Dispensa de licitação
861/2018 Equipamentos/Produtos de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CLORIDRATO DE DIFENIDRAMINA 50MG/ML, SOLUÇÃO INJETÁVEL, AMPOLA COM 1ML
Descrição: CLORIDRATO DE DIFENIDRAMINA 50MG/ML, SOLUÇÃO INJETÁVEL, AMPOLA COM 1ML. PRAZO DE VALIDADE SUPERIOR A UM ANO NO MOMENTO DE ENTREGA. MEDICAMENTO COM REGISTRO NA ANVISA.
25Ampola


21178/2018
30/05/2018 16:00:00
Dispensa de licitação
862/2018 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: rolo de Fita de papel crepe adesiva 19mm x 50metros
Descrição: 20 rolos de Fita de papel crepe adesiva 19mm x 50metros
30Rolo
Produto/Serviço: rolo de Fita crepe adesiva 19mm x 50metros zebrada para autoclave
Descrição: 5 rolos de Fita crepe adesiva 19mm x 50metros zebrada para autoclave
5Unidade


21200/2018
30/05/2018 16:00:00
Dispensa de licitação
863/2018 Contratação de Outros Serviços
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Instalação de sistema de drenagem externo
Descrição: Especificação: Instalação de sistema de drenagem externo, com instalação de caixa para decantação de resíduos, nas pias de lavagem de material e remoção de revestimento de sementes para análise de Determinação de Outras Sementes por Número nas amostras de lotes de sementes revestidas. A empresa deve executar o serviço e fornecer todo o material necessário. Deve ser feita a instalação da tubulação passando por dentro dos armários e seguindo pelo canto das câmaras frias, chegando até as paredes da garagem da SFA-MG ligando na tubulação lá presente para que chegue até a rede de esgoto.
1Unidade